Phospho-ATRIP (Ser68) Antibody

What is ATRIP and what is the significance of its Ser68 phosphorylation site?

ATRIP (ATR Interacting Protein) is an essential component of the DNA damage checkpoint. The protein binds to single-stranded DNA coated with replication protein A and interacts with the ataxia telangiectasia and Rad3 related protein kinase (ATR), resulting in its accumulation at intranuclear foci induced by DNA damage .

Phosphorylation of ATRIP at Serine 68 is biologically significant as it relates to the ATR kinase pathway activation, which plays a key role in DNA damage response and cell cycle regulation . Similar to CENP-A Ser68 phosphorylation (which controls centromeric deposition), the phosphorylation status of ATRIP Ser68 appears to be dynamically regulated during the cell cycle and in response to genotoxic stress .

What are the recommended applications for Phospho-ATRIP (Ser68) antibodies?

Based on manufacturer specifications and validation data, Phospho-ATRIP (Ser68) antibodies are primarily validated for these applications:

When designing experiments, it's important to note that most antibodies detect endogenous levels of ATRIP only when phosphorylated at Serine 68 . This specificity makes them valuable for studying phosphorylation events but requires proper controls to ensure accurate interpretation.

How can I validate the specificity of a Phospho-ATRIP (Ser68) antibody?

Validating phospho-specific antibodies requires multiple approaches to ensure reliable results:

• Phosphatase treatment control: Treat half of your sample with lambda phosphatase before immunoblotting. The signal should disappear in the treated sample if the antibody is truly phospho-specific.

• Phospho-blocking peptide competition: Use a synthetic phosphopeptide corresponding to the Ser68 region. As described in product documentation: "Blocking peptides are peptides that bind specifically to the target antibody and block antibody binding. These peptides usually contain the epitope recognized by the antibody" . Compare staining with and without the blocking peptide to identify specific signals.

• Genetic validation: Use ATRIP knockout/knockdown cells or ATRIP Ser68 mutant constructs (S68A) as negative controls. Several studies have used ATRIP siRNA duplexes targeting the sequence AAGGUCCACAGAUUAUUAGAU for knockdown experiments .

• Induction experiments: Treat cells with DNA damaging agents known to induce ATRIP phosphorylation and verify increased signal compared to untreated cells .

What is the relationship between ATRIP Ser68 phosphorylation and the ATR kinase pathway?

The relationship between ATRIP Ser68 phosphorylation and ATR kinase function appears complex and somewhat controversial in the literature. Several key findings:

• ATRIP is phosphorylated in an ATR-dependent manner after genotoxic stimuli .

• Serine 68 and 72 residues have been identified as important for phosphorylation in vivo and are direct modification targets by ATR in vitro .

• Using phospho-specific antibodies, researchers have demonstrated that phosphorylated ATRIP accumulates at DNA damage-induced foci .

• Interestingly, "the loss of phosphorylation does not lead to detectable changes in the relocalization of ATRIP to nuclear foci nor in the activation of downstream effector proteins" .

This suggests a nuanced role where Ser68 phosphorylation may be a marker of ATR pathway activation rather than a functional necessity for the initial damage response. This distinction is important when designing experiments to study the temporal dynamics of the ATR-ATRIP pathway.

How do ATM, ATR, and DNA-PK differentially contribute to ATRIP and RPA phosphorylation?

ATM, ATR, and DNA-PK are key upstream damage response signaling kinases with overlapping but distinct roles in phosphorylating targets like ATRIP and RPA:

• ATR primarily targets ATRIP at Ser68 and Ser72 in response to genotoxic stress .

• Pattern of phosphorylation is complex with evidence for "distinct RPA32 phosphorylation pathways mediated by PIKKs with overlapping RPA32 target specificities that vary with replication stress agent and cell cycle phase" .

• Priming phosphorylation events create hierarchical dependencies: "phosphorylation of certain residues requires prior phosphorylation of other residues" . For example, with camptothecin treatment, "blocking Ser33 phosphorylation with a Ser33Ala mutation suppresses other phosphorylation events" .

• Technical challenges in attribution: "Studies with DNA-PKcs mutant human cells, M059J, are difficult to interpret because these cells express ATM at low levels" , highlighting the importance of using multiple approaches to determine kinase specificity.

To experimentally determine which kinase is responsible for ATRIP Ser68 phosphorylation in your specific context, consider:

• Using specific inhibitors (with appropriate controls)

• Kinase knockdown/knockout approaches

• In vitro kinase assays with purified components

How can I optimize detection of phosphorylated ATRIP in cell-based assays?

For robust detection of phosphorylated ATRIP in cell-based assays, consider these methodological recommendations:

• Cell lysis conditions: Use phosphatase inhibitors in all buffers to prevent dephosphorylation during sample preparation. Common inhibitors include sodium fluoride, sodium orthovanadate, and phosphatase inhibitor cocktails.

• Signal enhancement strategies:

  • Pre-treat cells with DNA damaging agents that induce ATRIP phosphorylation

  • Synchronize cells at cell cycle phases where phosphorylation is maximal

  • Consider using proteasome inhibitors if protein turnover is high

• ELISA-based detection: For quantitative measurement, specialized kits like the "ATRIP Phospho-Ser68 Colorimetric Cell-Based ELISA Kit" are available. This format "offers high sensitivity and specificity, resulting in precise and consistent results" .

• Technical specifications: Most phospho-ATRIP antibodies detect a band at approximately 80-86 kDa . Sample experimental conditions from publications show: "PVDF membrane was probed with 1 μg/mL of Human ATRIP Antigen Affinity-purified Polyclonal Antibody followed by HRP-conjugated Anti-Sheep IgG Secondary Antibody" .

• Controls: Include non-phosphorylated ATRIP detection in parallel to normalize for total protein levels.

What are the contradictions in literature regarding the functional significance of ATRIP Ser68 phosphorylation?

The literature shows interesting contradictions regarding ATRIP Ser68 phosphorylation:

These contradictions could be explained by:

• Context-dependent functions: The role may vary depending on cell type, cell cycle phase, or type of DNA damage.

• Redundant mechanisms: Other phosphorylation sites or mechanisms may compensate when Ser68 phosphorylation is abolished.

• Temporal dynamics: Ser68 phosphorylation may be dispensable for initial activation but required for sustained response or adaptation.

To address these contradictions experimentally, consider:

• Testing multiple cell types

• Using diverse DNA damage inducers

• Performing time-course experiments

• Using phosphomimetic (S68D/E) and phospho-dead (S68A) mutants

What are the best experimental controls when using Phospho-ATRIP (Ser68) antibodies?

Proper controls are essential for interpreting results with phospho-specific antibodies:

• Positive controls:

  • Cells treated with DNA damaging agents known to induce ATRIP phosphorylation

  • Recombinant phosphorylated ATRIP protein

  • Cell lines with constitutively active ATR pathway

• Negative controls:

  • ATRIP knockout/knockdown cells

  • Phosphatase-treated samples

  • ATRIP S68A mutant expression

• Specificity controls:

  • Blocking peptide competition assays using "synthesized peptide derived from human ATRIP around the phosphorylation site of Ser68. AA range:34-83"

  • Dual detection with total ATRIP antibody

• Technical controls:

  • Loading controls (β-actin, GAPDH)

  • Signal normalization controls

The Phospho Explorer Antibody Array includes "beta-actin | GAPDH | Negative controls" and can be useful for multi-target phosphorylation analysis.

How can I design experiments to study the kinetics of ATRIP Ser68 phosphorylation?

To study phosphorylation kinetics effectively:

• Time-course experiments:

  • Treat cells with DNA damaging agents (UV, hydroxyurea, etc.)

  • Collect samples at multiple timepoints (0, 5, 15, 30, 60, 120 minutes)

  • Analyze phosphorylation by Western blot or ELISA

  • Include total ATRIP detection for normalization

• Cell synchronization:

  • Synchronize cells at different cell cycle phases

  • Release and monitor ATRIP phosphorylation during cycle progression

  • Correlate with other cell cycle markers

• Recovery dynamics:

  • Induce DNA damage

  • Remove damaging agent

  • Monitor phosphorylation decay/persistence during recovery

• Quantification methods:

  • Densitometry of Western blots

  • Fluorescence intensity in immunostaining

  • ELISA-based quantification

• Data analysis:

  • Plot phosphorylation versus time

  • Calculate rate constants

  • Compare kinetics across different conditions

What high-throughput approaches can be used to study ATRIP phosphorylation in multiple experimental conditions?

For high-throughput analysis of ATRIP phosphorylation:

• Phospho-specific antibody arrays:

  • The Phospho Explorer Antibody Array features "1318 site-specific and phospho-specific antibodies from over 30 signaling pathways"

  • Allows simultaneous analysis of multiple phosphorylation events

  • Suitable for comparing "normal samples to treated or diseased samples"

• Cell-based ELISA platforms:

  • Systems like the "ATRIP Phospho-Ser68 Colorimetric Cell-Based ELISA Kit" enable "high throughput and sensitive assay" in a 96-well format

  • Allow testing multiple conditions with replicate samples

  • Provide quantitative data

• Mass spectrometry-based approaches:

  • Phosphopeptide enrichment followed by MS/MS analysis

  • Label-free or isotope labeling methods for quantification

  • Can discover novel phosphorylation sites

• Automated microscopy:

  • Immunofluorescence detection of phospho-ATRIP

  • High-content imaging systems

  • Analysis of subcellular localization and co-localization with other markers

• Combination with genetic screens:

  • CRISPR libraries targeting DNA damage response genes

  • siRNA screens

  • Monitor effects on ATRIP phosphorylation

When designing high-throughput experiments, ensure appropriate normalization controls and statistical analysis to account for technical variability across plates or batches.

How does ATRIP Ser68 phosphorylation compare to other phosphorylation events in the DNA damage response network?

ATRIP Ser68 phosphorylation fits into a broader network of phosphorylation events in the DNA damage response:

• Hierarchical phosphorylation events:

  • Similar to RPA32 where "phosphorylation of certain RPA32 residues requires prior phosphorylation of other residues"

  • These "priming effects occur both in cis and in trans"

• Parallel pathways:

  • ATM, ATR, and DNA-PK mediate "distinct phosphorylation pathways" with "overlapping target specificities"

  • These vary "with replication stress agent and cell cycle phase"

• Comparative phosphorylation dynamics:

  • Some phosphorylation events (like RPA Ser4/Ser8) are "found only in the most hyperphosphorylated form" and represent "final events in the maturation of DNA damage-induced hyperphosphorylated" proteins

  • ATRIP Ser68 phosphorylation appears to be an earlier event in the cascade

• Functional significance spectrum:

  • Some phosphorylation events are essential (like CENP-A Ser68 where mutations "severely impairs CENP-A deposition and cell viability" )

  • Others may be "dispensable for the initial response to DNA damage"

What are the technical considerations for detecting multiple phosphorylation sites on ATRIP simultaneously?

For comprehensive phosphorylation analysis of ATRIP:

• Multiplex antibody approaches:

  • Use antibodies with different species origins

  • Apply fluorescent secondary antibodies with distinct spectra

  • Consider stripping and re-probing protocols for Western blots

• Mass spectrometry strategies:

  • Targeted MS/MS approaches

  • Phosphopeptide enrichment using TiO₂ or IMAC

  • Parallel reaction monitoring (PRM) for quantification

• Challenges to address:

  • Antibody cross-reactivity between similar phosphorylation motifs

  • Sequential phosphorylation dependencies affecting epitope accessibility

  • Low abundance of multiply-phosphorylated species

• Integrated data analysis:

  • Correlation analysis between different phosphorylation sites

  • Pathway modeling of phosphorylation networks

  • Machine learning approaches for pattern recognition

• Validation strategies:

  • Phospho-site mutants (single and combinatorial)

  • In vitro kinase assays with purified components

  • Phosphatase treatment controls

This multi-faceted approach enables researchers to build a comprehensive picture of how ATRIP phosphorylation is regulated and its functional consequences in the DNA damage response.