Phospho-BIRC5 (Thr117) Antibody

Shipped with Ice Packs
In Stock

Description

Introduction to Phospho-BIRC5 (Thr117) Antibody

Phospho-BIRC5 (Thr117) Antibody is a specialized reagent designed to detect phosphorylated survivin at the threonine 117 residue (Thr117). Survivin, encoded by the BIRC5 gene, is a multifunctional protein critical for mitosis regulation and apoptosis inhibition. The Thr117 phosphorylation site is a key post-translational modification (PTM) mediated by Aurora B kinase (AURKB), which modulates survivin’s interaction with chromosomal passenger complex (CPC) components and its subcellular localization during cell division .

Role of Thr117 Phosphorylation

  • Regulation by Aurora B Kinase: Phosphorylation at Thr117 by AURKB disrupts survivin’s interaction with INCENP (a CPC component), preventing its localization to mitotic chromosomes .

  • Mitotic Function: This modification inversely regulates survivin’s role in chromosome alignment, segregation, and cytokinesis .

  • Anti-apoptotic Activity: Thr117 phosphorylation may destabilize survivin’s protective role against apoptosis during mitosis .

Subcellular Localization

Survivin dynamically localizes to:

  • Centromeres (prophase to metaphase)

  • Spindle midzone (anaphase)

  • Midbody (telophase/cytokinesis) .
    Phosphorylation at Thr117 reduces centromeric chromatin affinity, altering CPC localization .

Recommended Dilutions

ApplicationDilution Range
Western Blot1:500 – 1:2000
IHC1:100 – 1:300
IF/ICC1:200 – 1:1000
ELISA1:5000

Research Use Cases

  • Mitosis Studies: Investigate CPC dynamics during chromosome segregation .

  • Cancer Research: Detect survivin overexpression in adenocarcinomas (lung, pancreas, colon) and lymphomas .

  • Apoptosis Pathways: Study survivin’s dual roles in cell proliferation and caspase inhibition .

Post-Translational Modifications of Survivin

Modification SiteTypeEnzymeFunctional Impact
Thr117PhosphorylationAurora B kinaseDisrupts CPC interaction; reduces chromatin binding
Thr34PhosphorylationCDK1Stabilizes survivin; enhances anti-apoptotic activity
Lys129AcetylationCBPPromotes nuclear retention; represses STAT3 signaling

Validation and Quality Control

  • Specificity: Recognizes endogenous survivin only when phosphorylated at Thr117 .

  • Cross-Reactivity: Confirmed in human, mouse, and rat tissues; predicted reactivity in pig, bovine, and dog .

  • Citations: RRID: AB_2834424 (Affinity Biosciences) ; STJ91292 (St John’s Labs) .

Clinical and Experimental Relevance

  • Cancer Biomarker: Survivin is overexpressed in malignancies, making Thr117 phosphorylation a potential therapeutic target .

  • Mitotic Dysregulation: Phospho-Thr117 status correlates with defects in cytokinesis and aneuploidy .

Limitations and Considerations

  • Research Use Only: Not validated for diagnostic or therapeutic applications .

  • Species Limitations: Limited data for non-mammalian models (e.g., zebrafish, chicken) .

Product Specs

Form
Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol.
Lead Time
Generally, we can ship the products within 1-3 business days after receiving your order. Delivery time may vary depending on the purchasing method or location. Please consult your local distributors for specific delivery times.
Synonyms
API4 antibody; Apoptosis inhibitor 4 antibody; Apoptosis inhibitor survivin antibody; Apoptosis inhibitor4 antibody; Baculoviral IAP repeat containing 5 antibody; Baculoviral IAP repeat containing protein 5 antibody; Baculoviral IAP repeat-containing protein 5 antibody; BIRC 5 antibody; BIRC5 antibody; BIRC5_HUMAN antibody; EPR 1 antibody; IAP4 antibody; Survivin variant 3 alpha antibody; SVV antibody; TIAP antibody
Target Names
Uniprot No.

Target Background

Function
Survivin is a multitasking protein with dual roles in promoting cell proliferation and inhibiting apoptosis. It is a component of the chromosome passage protein complex (CPC), which is essential for chromosome alignment and segregation during mitosis and cytokinesis. Survivin acts as a crucial regulator of CPC localization, directing its movement to different locations, from the inner centromere during prometaphase to the midbody during cytokinesis. It also participates in the organization of the central spindle by associating with polymerized microtubules. Survivin is involved in the recruitment of CPC to centromeres during early mitosis through its association with histone H3 phosphorylated at Thr3 (H3pT3) during mitosis. The complex with RAN plays a role in mitotic spindle formation by serving as a physical scaffold to deliver the RAN effector molecule TPX2 to microtubules. Survivin may counteract a default induction of apoptosis in the G2/M phase. The acetylated form represses STAT3 transactivation of target gene promoters. It may play a role in neoplasia and is an inhibitor of CASP3 and CASP7. Survivin is essential for the maintenance of mitochondrial integrity and function. Isoforms 2 and 3 do not appear to play vital roles in mitosis. Isoform 3 shows a significant reduction in its anti-apoptotic effects compared to the wild-type isoform.
Gene References Into Functions
  1. NF-kappaB activation may induce resistance to apoptosis through the expression of anti-apoptotic genes such as Survivin, which showed a progressive increase in expression throughout the esophageal metaplasia-dysplasia-adenocarcinoma sequence. PMID: 29473241
  2. This study demonstrates that ZIC1 plays a tumor suppressive role in breast cancer, by targeting Survivin, significantly downregulating its expression. PMID: 29956756
  3. This study observed that smoking patients had higher Survivin transcription and a remarkable spreading of Survivin isoforms, when studying Survivin expression in leukocytes of 144 female rheumatoid arthritis patients. PMID: 27915033
  4. Our findings identify Survivin as a target of HO-1 and a mediator of adipocyte-induced survival in the metastatic niche. PMID: 29311669
  5. High BIRC5 expression is associated with gefitinib resistance in lung cancer. PMID: 30106446
  6. miR-203 expression also inhibited primary tumor growth in ovaries and metastatic tumors in multiple peritoneal organs including liver and spleen. miR-203 inhibits ovarian tumor metastasis by targeting BIRC5/Survivin and attenuating the TGFbeta pathway. PMID: 30241553
  7. Survivin may be implicated in the bcl-2 and p53 pathways and therefore in the biology of PDAC. Its potential use as a survival predictor and therapeutic target represents a promising field. PMID: 30249893
  8. A study in hepatocellular carcinoma cell line elicited a new mechanism in which IGF-1 induced epithelial-mesenchymal transition through regulation of Survivin and a downstream pathway. PMID: 29989646
  9. In the present study, liposome-plasmid DNA encoding mutant SurvivinT34A could inhibit tumor growth of cervical cancer. This inhibition may be associated with an increase in the apoptosis rate of tumor cells and a reduction in angiogenesis. PMID: 29767242
  10. Simvastatin significantly inhibited the proliferation and invasion of SACC83 cells, induced apoptosis, and reduced the expression of Survivin, suggesting that simvastatin may be a novel target for salivary gland adenoid cystic carcinoma therapy. PMID: 29956779
  11. Survivin is significantly up-regulated in hepatocellular carcinoma (HCC) tissues and associated with tumor growth and lymph node metastasis. Clinical detection of Survivin levels combined with MRI examination might be beneficial for clinical diagnosis and treatment of HCC PMID: 30010107
  12. Our study identified the STAT3 rs1053004 C/C as a high-risk genotype in MA with lower Survivin and VEGF transcription levels in the peripheral blood. PMID: 30226700
  13. Overexpression of miR-485-5p suppresses breast cancer progression and enhances chemosensitivity. Further study demonstrated that miR-485-5p directly targeted the 3'-untranslated region of Survivin, and overexpression of Survivin overcomes the miR-485-5p induced effects on breast cancer. PMID: 29678577
  14. Survivin expression in gastric cancer cells is regulated by DEC1. PMID: 29204860
  15. High serum Survivin levels with GG genotype are associated with Brain Tumors. PMID: 30275230
  16. LNC473 could recruit deubiquitinase USP9X to inhibit the ubiquitination level of Survivin and then increase Survivin expression. PMID: 29605299
  17. Oct4 plays a vital role in the malignant progression of HCC cells through the Survivin/STAT3 signaling pathway. PMID: 29901157
  18. Our study results may suggest that high serum Survivin levels can show a 4 times increased risk of cancer in a subject with a high suspicion of cancer. Furthermore, Survivin level was not influenced with demographic characteristics of breast, gastric, colorectal, prostate, ovarian cancer, and glioblastome multiforme. PMID: 29893319
  19. These findings collectively suggest that the triple combination of Survivin knockdown with ABT-263 and trametinib treatment, may be a potential strategy for the treatment of KRAS-mutant lung adenocarcinoma. Furthermore, our findings indicate that the well-differentiated type of KRAS-mutant lung tumors depends, at least in part, on TTF1 for growth. PMID: 29658609
  20. Targeting the Cripto-1/TAK-1/NF-kappaB/Survivin pathway may be an effective approach to combat apoptosis resistance in cancer. PMID: 29807222
  21. Suggests that SIRT1 may serve as a predictor of poor prognosis in esophageal squamous cell carcinoma, and its mediated tumor-promoting role might be associated with the overexpression of EGFR protein in esophageal squamous cell carcinoma PMID: 29625788
  22. CSN5 directly bound Survivin and decreased its ubiquitination to enhance the protein stability of Survivin. PMID: 29596838
  23. The Survivin gene 3' UTR polymorphisms (rs17878624) show that the GG genotype provides substantial protection from non-small-cell lung carcinoma. PMID: 29631694
  24. Concomitant high expression of Survivin and VEGF-C is closely associated with LNM status of PTC patients, suggesting their cooperation in the metastatic process. PMID: 29578160
  25. In leukoplakia, the expression of Survivin associated with that of ki-67 reinforces the assumption that all these lesions are potentially malignant. PMID: 28346726
  26. This study showed for the first time that the suppression of rheumatoid arthritis fibroblast-like synoviocyte was mediated by phosphatase and tensin homolog involving Survivin silencing. PMID: 28337018
  27. ERCC1 expression may also inhibit esophageal squamous cell carcinoma cell apoptosis via regulating Survivin expression, and ERCC1 and Survivin overexpression are independent predictors of prognosis for ESCC patients who receive chemotherapy and/or radiotherapy PMID: 30075571
  28. let-7b targets PLK1 to inhibit hepatocellular carcinoma cell growth and induce their apoptosis by attenuating the PLK1-mediated Survivin phosphorylation PMID: 29913237
  29. Overexpression of Survivin in glioma cells induces chromosomal instability PMID: 29282022
  30. High BIRC5 expression is associated with ovarian cancer. PMID: 29795564
  31. In the third trimester of pregnancy, parameters of Timp-1 and Survivin - anti-apoptotic substances concentration were similar in maternal and cord blood in both artery and vein. We found no increased activity of selected antiapoptotic factors. PMID: 28509321
  32. Results from a study in non-small-cell lung cancer cells showed that SphK2 plays a critical role in doxorubicin-induced resistance by regulating key anti-apoptotic gene, Survivin. PMID: 28950390
  33. Survivin overexpression plays a key role in the chemoresistance of ovarian CSCs. PMID: 30061219
  34. Survivin may play an important role in the occurrence and development of laryngeal carcinoma, and its high expression is related to the poor prognosis of patients with laryngeal cancer. (Meta-analysis) PMID: 29270761
  35. Treatment of DLD1 cells with tamoxifen, beta-estradiol, or a combination of these two drugs, inhibited cell viability and migration, promoted cell apoptosis, and reduced the mRNA and protein expression levels of Survivin in a dose and time-dependent manner. These results provide novel experimental basis for hormonal adjuvant therapy for the treatment of colorectal cancers PMID: 28849238
  36. Studies indicated that high Survivin expression in renal cell carcinoma (RCC) was associated with poor overall survival [Review]. PMID: 27411378
  37. Nuclear accumulation of Survivin is associated with a proliferative phenotype and was shown to be a worse prognostic marker in breast ductal carcinoma. PMID: 29517199
  38. Knockdown of BIRC5, a member of the inhibitor of apoptosis protein family, using either lentiviral vector-based CRISPR/Cas9 nickase gene editing or inhibition of Survivin using the small-molecule inhibitor YM155, results in the suppression of epithelial to mesenchymal transition in retinal pigment epithelial cells. PMID: 29522718
  39. By downregulation of Sp1 and Survivin at the late phase of treatment. PMID: 28713892
  40. The expressions of Survivin and STAT2 are up-regulated in skin lesions of PV patients, and their mRNA expressions are positively correlated. PMID: 29089085
  41. Findings suggest that lysosome-associated transmembrane protein 4B (LAPTM4B), vascular endothelial growth factor (VEGF), and nuclear Survivin expression are significantly correlated in breast cancer, which may be predictive of prognosis as well as effective therapeutic targets for anticancer therapies. PMID: 28476037
  42. HIF-2alpha dictates the resistance of human pancreatic cancer cells to TRAIL under normoxic and hypoxic conditions and transcriptionally regulates Survivin expression. PMID: 28476028
  43. Survivin may have a role in recurrence in rectal cancer patients treated with surgery and postoperative concurrent chemo-radiation therapy PMID: 27391438
  44. Results identified BIRC5 to be significantly upregulated in the lung squamous cell carcinoma tissues of smoking patients and may play an important role in diagnosis and prognosis. PMID: 28949095
  45. After cancer cell fusion, some fused cells avoid the apoptotic crisis partly owing to Survivin, and continue to proliferate, a process that contributes to human cancer progression. PMID: 28193315
  46. High Survivin expression is associated with lung cancer and colorectal cancer. PMID: 27602754
  47. Data suggest that Ki-67 index and Survivin may be useful biomarkers for rectal cancer with preoperative chemoradiotherapy. PMID: 29491110
  48. Inhibition of apoptosis targeting Survivin might represent an effective strategy for both obesity and cancer therapy. PMID: 28518147
  49. FAT10 promotes tumor proliferation by directly stabilizing Survivin protein in breast cancer cells. PMID: 27806337
  50. Nuclear Survivin is a prognostic marker for the progression of oral squamous cell carcinomas. PMID: 28384094

Show More

Hide All

Database Links

HGNC: 593

OMIM: 603352

KEGG: hsa:332

UniGene: Hs.744872

Protein Families
IAP family
Subcellular Location
Cytoplasm. Nucleus. Chromosome. Chromosome, centromere. Cytoplasm, cytoskeleton, spindle. Chromosome, centromere, kinetochore. Midbody.
Tissue Specificity
Expressed only in fetal kidney and liver, and to lesser extent, lung and brain. Abundantly expressed in adenocarcinoma (lung, pancreas, colon, breast, and prostate) and in high-grade lymphomas. Also expressed in various renal cell carcinoma cell lines. Ex

Q&A

What is Phospho-BIRC5 (Thr117) Antibody and what are its specifications?

Phospho-BIRC5 (Thr117) Antibody is a rabbit polyclonal antibody specifically designed to detect Survivin protein only when phosphorylated at the Threonine 117 position . This antibody is produced through affinity purification via sequential chromatography on phospho- and non-phospho-peptide affinity columns to ensure high specificity . Key specifications include:

SpecificationDetails
Target ProteinPhospho-Survivin (Thr117)
ClonalityPolyclonal
Host SpeciesRabbit
ReactivityHuman, Mouse, Rat
Predicted Cross-ReactivityPig, Bovine, Horse, Sheep, Dog
Molecular Weight16 kDa
ApplicationsWB, IHC, IF/ICC
UniProt AccessionO15392

The antibody is typically stored in phosphate-buffered saline (pH 7.4) containing 150mM NaCl, 0.02% sodium azide, and 50% glycerol, and remains stable for approximately 12 months when stored at -20°C .

How does phosphorylation at Thr117 affect Survivin function?

Survivin undergoes several post-translational modifications, with phosphorylation being particularly important for regulating its varied cellular functions . While phosphorylation at Thr34 is well-documented for its role in anti-apoptotic activity, Thr117 phosphorylation represents a distinct regulatory mechanism .

Phosphorylation at different sites provides survivin with diverse molecular functions:

  • Thr34 phosphorylation (regulated by CDK1/P34cdc2 cyclin B1) enhances cytoprotective effects and is necessary for anti-apoptotic activity

  • Thr117 phosphorylation modulates survivin's role in cell cycle regulation and potentially its interactions with other chromosome passenger complex components

Unlike other Inhibitor of Apoptosis Proteins (IAPs), survivin contains only one Baculoviral IAP Repeat (BIR) domain, highlighting the significance of its phosphorylation sites in determining functional specificity .

What tissue distribution patterns are observed for Survivin expression?

Survivin exhibits a highly regulated expression pattern that varies significantly between normal and pathological conditions:

Normal Tissues:

  • Expressed predominantly in fetal kidney and liver

  • Lower expression in fetal lung and brain

  • Present in cochlea including the organ of Corti, lateral wall, interdental cells of the Limbus

  • Found in Schwann cells and cells of the cochlear nerve and spiral ganglions

  • Notably absent in cells of the inner and outer sulcus or the Reissner's membrane

Pathological Conditions:

  • Abundantly expressed in various adenocarcinomas (lung, pancreas, colon, breast, and prostate)

  • Highly expressed in high-grade lymphomas

  • Present in renal cell carcinoma cell lines

  • Elevated expression in PBMCs of patients with Behcet's disease

This distinctive expression pattern makes survivin and its phosphorylated forms potential biomarkers for various pathological conditions.

What methodological approaches are recommended for detecting phosphorylated survivin in different sample types?

Detection of phosphorylated survivin requires careful methodological consideration depending on sample type and research objectives:

For PBMC Samples:

  • Cell harvesting followed by protein extraction using appropriate lysis buffers

  • Western blot analysis using anti-phosphorylated-survivin antibodies (specific to the phosphorylation site of interest)

  • Comparison with total survivin levels using pan-survivin antibodies

  • Use of β-actin as a loading control

For Plasma Samples:

  • Collection of plasma with appropriate anticoagulants

  • Protein precipitation or direct analysis depending on concentration

  • Western blot analysis for qualitative assessment

  • Enzyme-linked immunosorbent assay (ELISA) for quantitative measurement

Recommended dilutions for various applications:

  • Western Blot: 1:500-1:2000

  • Immunohistochemistry: 1:50-1:200

  • Immunofluorescence/Immunocytochemistry: 1:100-1:500

How can researchers quantify BIRC5 mRNA expression alongside protein phosphorylation studies?

A comprehensive analysis of survivin biology often requires examination at both mRNA and protein levels. For BIRC5 mRNA quantification:

  • Extract total RNA from PBMCs using high-quality RNA isolation kits

  • Synthesize cDNA using reverse transcription

  • Perform quantitative real-time PCR using specific primers:

    • Survivin Forward: ATTTGATTCGCCCTCCTCCC

    • Survivin Reverse: TCCAGAGGTTTCCAGCGAAG

    • GAPDH Forward: AATGGGCAGCCGTTAGGAAA (reference gene)

    • GAPDH Reverse: GCCCAATACGACCAAATCAGAG

  • Calculate relative expression using the ΔΔCt method

This approach allows correlation between mRNA expression and phosphorylation status to understand both transcriptional and post-translational regulation.

What are the differences in phosphorylated survivin expression between plasma and PBMCs in disease states?

Research on Behcet's disease has revealed intriguing differences in phosphorylated survivin expression between cellular and circulating compartments:

PBMCs:

  • Increased expression of phosphorylated survivin in Behcet's disease patients compared to healthy controls

  • Particularly elevated phosphorylation at Thr34 in patients with active disease

Plasma:

  • Downregulation of phosphorylated survivin levels in Behcet's disease patients compared to healthy individuals

  • Total survivin levels in plasma show no significant differences between patients and controls (p>0.05)

This differential expression suggests compartment-specific regulation of survivin phosphorylation and potential translocation mechanisms that may contribute to disease pathogenesis.

How does phosphorylated survivin contribute to autoimmune pathogenesis?

Survivin plays multiple roles in immune cell function, with phosphorylation status influencing its contribution to autoimmune pathogenesis:

  • Apoptosis Dysregulation: Defective apoptosis is a fundamental problem in autoimmune diseases, and survivin acts as an anti-apoptotic protein that can inhibit caspase 3 function

  • Cell Cycle Disruption: Survivin interferes during the G2/M phase of mitosis in deregulated cell cycle checkpoints to promote abnormal cell survival

  • Immune Cell Development: Survivin is critical for proliferation, maturation, homeostasis, and differentiation of effector and memory lymphocytes

  • Gene Expression Changes: BIRC5 gene expression is increased in Behcet's disease patients compared to healthy controls (p<0.05)

The increased expression of phosphorylated survivin in PBMCs of autoimmune patients suggests it could serve as a potential biomarker for disease activity and therapy monitoring .

What are the known splice variants of BIRC5 and how might they affect antibody detection?

The BIRC5 gene encodes several spliced variants with different amino acid compositions:

VariantLength (amino acids)Potential Effect on Antibody Detection
Wild type142Standard detection target
ΔEx3137May affect epitope accessibility
2B165Additional amino acids could alter conformation
3B120Shortened protein may lack Thr117 site
74Likely lacks Thr117 phosphorylation site
78Likely lacks Thr117 phosphorylation site

Researchers should be aware that alternative splicing may affect the presence or accessibility of the Thr117 phosphorylation site . Validation experiments using positive and negative controls are essential when working with different cell types or tissues that might express varying splice variants.

Quick Inquiry

Personal Email Detected
Please use an institutional or corporate email address for inquiries. Personal email accounts ( such as Gmail, Yahoo, and Outlook) are not accepted. *
© Copyright 2025 TheBiotek. All Rights Reserved.