Phospho-CCND2 (Thr280) Antibody

What is Phospho-CCND2 (Thr280) Antibody?

Phospho-CCND2 (Thr280) Antibody is a rabbit polyclonal antibody that specifically detects endogenous levels of G1/S-specific cyclin-D2 protein only when phosphorylated at threonine 280. It is produced by immunizing rabbits with synthetic phosphopeptides derived from human Cyclin D2 around the phosphorylation site of Thr280, followed by affinity purification to remove non-phospho specific antibodies. This research tool is particularly valuable for studying cell cycle regulation mechanisms involving CCND2 phosphorylation states .

What is the biological function of CCND2 and its phosphorylation at Thr280?

CCND2 (Cyclin D2) functions as a regulatory component of the cyclin D2-CDK4 (DC) complex that phosphorylates and inhibits members of the retinoblastoma (RB) protein family, including RB1, regulating the cell cycle during G1/S transition. Phosphorylation of RB1 allows dissociation of the transcription factor E2F from the RB/E2F complex, enabling transcription of genes responsible for G1 phase progression. Phosphorylation at Thr280 specifically marks CCND2 for polyubiquitination and subsequent proteasomal degradation, creating a critical regulatory mechanism for controlling CCND2 protein levels and activity . When this phosphorylation is prevented, as in the Thr280Ala mutation, CCND2 becomes stabilized, leading to enhanced cell proliferation and potential pathological consequences .

What applications is Phospho-CCND2 (Thr280) Antibody validated for?

Phospho-CCND2 (Thr280) Antibody has been validated for multiple research applications:

This versatility allows researchers to detect phosphorylated CCND2 across various experimental platforms, from protein lysates to fixed tissue sections and cultured cells .

How should Phospho-CCND2 (Thr280) Antibody be stored and handled?

For optimal stability and activity, Phospho-CCND2 (Thr280) Antibody should be stored at -20°C or -80°C. The antibody is typically formulated in PBS containing 50% glycerol, 0.5% BSA, and 0.02% sodium azide, which helps maintain its stability. Repeated freeze-thaw cycles should be avoided as they can degrade the antibody and reduce its effectiveness. When properly stored, the antibody remains viable for up to 1 year from the date of receipt .

How does the Thr280Ala mutation affect CCND2 function in cellular models?

The Thr280Ala mutation in CCND2 has profound effects on protein function and cellular behavior:

• Prevention of Phosphorylation: The mutation eliminates the threonine residue that would normally be phosphorylated, rendering the protein resistant to this post-translational modification .

• Enhanced Protein Stability: Without phosphorylation at Thr280, CCND2 cannot be properly polyubiquitinated, making it resistant to proteasomal degradation and leading to increased protein accumulation .

• Increased RB Phosphorylation: Cells expressing Thr280Ala mutant CCND2 show elevated phosphorylation of retinoblastoma protein, accelerating cell cycle progression .

• Enhanced Cell Proliferation: In vivo experiments using in utero electroporation demonstrate that Thr280Ala mutant CCND2 significantly increases the percentage of proliferating cells (54.9 ± 4.9%) compared to wild-type CCND2 (27.6 ± 3.0%) and phosphomimetic Thr280Asp (35.5 ± 5.3%) .

• Mitosis Promotion: The phosphodeficient form of CCND2 (Thr280Ala) is more effective in promoting mitosis (6.41 ± 0.22% of GFP+ cells co-labeling with PH3) compared to wild-type CCND2 (2.83 ± 0.37%) .

These alterations have been implicated in megalencephaly-polymicrogyria-polydactyly-hydrocephalus syndrome (MPPH) and certain cancers, highlighting the critical importance of proper CCND2 regulation in normal development and disease prevention .

What experimental approaches can verify the specificity of Phospho-CCND2 (Thr280) Antibody?

Several rigorous approaches can be employed to verify the specificity of Phospho-CCND2 (Thr280) Antibody:

• Peptide Competition Assay: Preincubate the antibody with the phospho-peptide used as immunogen. This should abolish or significantly reduce the signal in Western blot or immunostaining if the antibody is specific .

• Phosphatase Treatment: Treating cell lysates with lambda phosphatase to remove phosphate groups should eliminate detection by the phospho-specific antibody .

• Mutation Studies: Compare detection in cells expressing wild-type CCND2 versus those expressing Thr280Ala mutant. The antibody should not detect the mutant form since it cannot be phosphorylated at position 280 .

• Stimulation Experiments: Treat cells with EGF (200ng/ml for 30 minutes), which has been shown to increase Thr280 phosphorylation, and compare with untreated controls .

• Knockout/Knockdown Controls: Use CCND2 knockout or knockdown cells to confirm absence of signal, validating that the detected protein is indeed CCND2.

These validation steps are crucial for ensuring reliable results in experiments utilizing the Phospho-CCND2 (Thr280) Antibody.

How can Phospho-CCND2 (Thr280) Antibody be used to study neural progenitor proliferation?

Phospho-CCND2 (Thr280) Antibody provides valuable insights into neural development through several methodological approaches:

• In Utero Electroporation Studies: This antibody can detect phosphorylation state changes in CCND2 following electroporation of wild-type or mutant CCND2 constructs into the developing brain. Research has shown that expression of phosphodeficient CCND2 (Thr280Ala) significantly increases the proportion of proliferating cells (Ki67-positive) in the ventricular/subventricular zones compared to wild-type CCND2 .

• Co-immunostaining with Cell Cycle Markers: Combining Phospho-CCND2 (Thr280) detection with markers such as Ki67 (proliferation) or phosphohistone H3 (M-phase) allows precise correlation between CCND2 phosphorylation state and specific cell cycle phases in neural progenitors .

• Quantitative Analysis of Mitotic Cells: Research has demonstrated that expression of phosphodeficient CCND2 increases the percentage of cells in M-phase (6.41 ± 0.22% of transfected cells) compared to wild-type CCND2 (2.83 ± 0.37%) or phosphomimetic CCND2 (3.39 ± 0.49%) .

• Developmental Time Course Studies: The antibody can be used to track changes in CCND2 phosphorylation patterns throughout neurogenesis, potentially revealing temporal regulation mechanisms.

These applications provide mechanistic insights into how post-translational modifications of CCND2 influence neural progenitor behavior and brain development, with implications for neurodevelopmental disorders like MPPH syndrome .

What are the optimal conditions for using Phospho-CCND2 (Thr280) Antibody in Western blot analyses?

For optimal results when using Phospho-CCND2 (Thr280) Antibody in Western blot analyses, researchers should consider the following conditions:

• Sample Preparation: Cells should be lysed in buffer containing phosphatase inhibitors (sodium orthovanadate, sodium fluoride, β-glycerophosphate) to preserve phosphorylation states. Fresh samples are recommended as phosphorylation can be lost during storage .

• Protein Loading: 20-50 μg of total protein per lane is typically sufficient for detection of endogenous phosphorylated CCND2.

• Dilution Range: The antibody works effectively at dilutions of 1:500-1:3000 for Western blotting, with 1:1000 being a good starting point .

• Blocking Solution: 5% BSA in TBST is preferred over milk-based blockers, as milk contains phosphatases that may reduce phospho-protein detection.

• Incubation Conditions: Primary antibody incubation at 4°C overnight typically yields better results than shorter incubations at room temperature.

• Positive Controls: Include lysates from cells treated with EGF (200ng/ml for 30 minutes), which has been shown to increase CCND2 Thr280 phosphorylation .

• Validation Controls: Running a parallel blot with synthetic phosphopeptide competition can confirm signal specificity .

Following these guidelines will help ensure specific and reproducible detection of phosphorylated CCND2 at Thr280.

What controls should be included when using Phospho-CCND2 (Thr280) Antibody?

Rigorous experimental controls are essential when working with Phospho-CCND2 (Thr280) Antibody:

• Positive Control: Include samples known to contain phosphorylated CCND2, such as extracts from COLO cells treated with EGF (200ng/ml for 30 minutes) .

• Negative Control: Use samples where phosphorylation is expected to be absent, such as serum-starved cells or samples treated with phosphatases.

• Peptide Competition Control: Pre-incubate the antibody with the phospho-peptide immunogen to confirm signal specificity. The signal should be significantly reduced or eliminated in this condition, as demonstrated in Western blot analyses of COLO cell extracts .

• Mutation Controls: When possible, include samples expressing Thr280Ala mutant CCND2, which cannot be phosphorylated at this site and should not be detected by the antibody .

• Total CCND2 Detection: Run parallel samples with an antibody against total CCND2 to distinguish between changes in phosphorylation versus total protein levels.

• Loading Control: Include detection of housekeeping proteins (e.g., GAPDH, β-actin) to normalize for total protein loading variations.

These controls significantly enhance the reliability and interpretability of experimental results obtained with the Phospho-CCND2 (Thr280) Antibody.

How can researchers differentiate between phosphorylated and non-phosphorylated forms of CCND2?

Several techniques can help researchers distinguish between phosphorylated and non-phosphorylated forms of CCND2:

• Parallel Antibody Detection: Use both phospho-specific (Phospho-CCND2 (Thr280) Antibody) and total CCND2 antibodies in parallel experiments .

• Phosphatase Treatment: Divide samples into two aliquots, treat one with lambda phosphatase, and perform Western blotting. The phospho-specific antibody should only detect the untreated sample.

• Phos-tag™ SDS-PAGE: This technique incorporates phosphate-binding molecules into gels, causing phosphorylated proteins to migrate more slowly, creating a mobility shift that separates phosphorylated from non-phosphorylated forms.

• Mutational Analysis: Compare detection between wild-type CCND2, phosphomimetic (Thr280Asp), and phosphodeficient (Thr280Ala) mutants. Research has shown clear functional differences between these forms in terms of cell proliferation and mitosis promotion .

• EGF Stimulation: Treatment with EGF (200ng/ml for 30 minutes) increases Thr280 phosphorylation and can be used to generate samples with enhanced phosphorylated CCND2 for comparative studies .

These approaches provide complementary information about the phosphorylation state of CCND2 and its functional implications in experimental systems.

What are the experimental considerations for studying CCND2 Thr280Ala mutants?

When studying CCND2 Thr280Ala mutants, several methodological considerations should be addressed:

• Cloning Strategy: The mutation can be introduced using a 1-basepair mismatch reverse primer. Previous research has used primers like: CCND2 clone F (gcgtgctagcatggagctgctgtgccacgag), CCND2 clone R (gcgtgaattcctcacaggtcgatatcccgcacgtctgtagggttg), and CCND2 mutR (cagcaaccctacagacgtgcgggatatcgacctgtgaggat) .

• Expression System: Lentiviral vectors such as pCDH-CMV-MCS-EF1-copGFP+Puro cDNA have been successfully used for stable expression of CCND2 mutants .

• Transfection Protocol: For viral production, transfect HEK-293TN cells with the lentiviral construct using appropriate transfection reagents. Collect viral supernatant after 48-72 hours and concentrate using precipitation solutions .

• Infection Efficiency: For cell infection, use approximately 20 IU of virus per 200,000 cells with transdection reagents to enhance infection efficiency .

• Validation of Expression: Confirm CCND2 overexpression at both RNA and protein levels 72 hours post-infection .

• Functional Assays: Cell viability can be assessed using chemiluminescent TiterGlo assays 72 hours after puromycin selection, using 20,000 cells in duplicate from three biological replicates .

• In Vivo Analysis: For developmental studies, in utero electroporation can be performed at embryonic day 13.5 with collection 48 hours later, followed by immunohistochemistry using anti-GFP and cell cycle markers like anti-Ki67 or phosphohistone H3 (PH3) .

These methodological details will facilitate reproducible studies of CCND2 Thr280Ala mutants and their functional consequences.

How does Phospho-CCND2 (Thr280) Antibody contribute to cancer research?

Phospho-CCND2 (Thr280) Antibody provides valuable insights for cancer research through several applications:

• Mechanism Exploration: This antibody allows investigation of mechanisms by which CCND2 phosphorylation status influences cancer cell proliferation and response to treatment .

• Mutational Screening: The antibody can help identify samples lacking Thr280 phosphorylation, potentially indicating mutations at this site which have been associated with certain cancers .

• Pathway Analysis: Detection of phosphorylated CCND2 can reveal activation of upstream signaling pathways in cancer cells, particularly following growth factor stimulation like EGF treatment .

• Treatment Response Monitoring: Changes in CCND2 phosphorylation following treatment with cell cycle-targeting drugs can provide mechanistic insights into therapeutic responses.

• Correlation with Proliferation: Studies can correlate phospho-CCND2 levels with cell proliferation metrics using assays such as TiterGlo, establishing functional relationships in cancer models .

These applications contribute to understanding dysregulated cell cycle control in cancer and may inform the development of targeted therapeutic approaches.

What is the significance of phosphorylation at Thr280 in CCND2 regulation and disease?

Phosphorylation at Thr280 plays a critical role in regulating CCND2 stability and function with significant implications for disease:

• Protein Degradation Control: Phosphorylation at Thr280 marks CCND2 for polyubiquitination and subsequent proteasomal degradation, regulating protein levels .

• Cell Cycle Progression: The phosphorylation state influences CCND2's ability to activate CDK4 and phosphorylate retinoblastoma protein. Preventing phosphorylation (as in Thr280Ala mutant) leads to enhanced RB phosphorylation and accelerated cell cycle progression .

• Neural Development Impact: Research using in utero electroporation demonstrates that phosphodeficient CCND2 (Thr280Ala) significantly increases neural progenitor proliferation (54.9 ± 4.9% Ki67+ cells) compared to wild-type (27.6 ± 3.0%) or phosphomimetic CCND2 (35.5 ± 5.3%) .

• Mitosis Regulation: The Thr280Ala mutation increases the proportion of cells in M-phase (6.41 ± 0.22%) compared to wild-type (2.83 ± 0.37%) or phosphomimetic CCND2 (3.39 ± 0.49%) .

• Disease Association: Mutations affecting Thr280 phosphorylation have been implicated in megalencephaly-polymicrogyria-polydactyly-hydrocephalus syndrome (MPPH) and may contribute to certain cancers, highlighting the clinical importance of this regulatory mechanism .

Understanding these regulatory mechanisms is essential for comprehending how dysregulation of CCND2 phosphorylation contributes to pathological conditions and may inform therapeutic strategies for related disorders.