Phospho-RBL1 (T369) Antibody

Basic Characterization and Properties

• What is RBL1/p107 and what cellular functions does it regulate?

  RBL1/p107 is a tumor suppressor protein that belongs to the retinoblastoma (RB) family and functions primarily as a cell cycle regulator. RBL1 is considered a G1/S gene with expression patterns that fluctuate during the cell cycle—levels are low in quiescent cells and increase significantly during the G1-to-S phase transition. The protein plays crucial roles in controlling cellular proliferation through its interaction with E2F transcription factors, particularly the repressors E2F4 and E2F5. While RBL1/p107 demonstrates tumor suppressor functions, it is generally considered a weaker tumor suppressor compared to RB1/p105, and its tumor-suppressive activities are often context-dependent. Recent research has also identified correlations between RBL1 variants and tumor T cell subset abundance, suggesting potential roles in immune surveillance mechanisms .

• What is the significance of RBL1 phosphorylation at Threonine 369?

  Phosphorylation at Threonine 369 (T369) represents one of the several regulatory post-translational modifications of RBL1/p107. This specific phosphorylation site is critical for modulating RBL1's activity during cell cycle progression. Similar to other RB family proteins, RBL1/p107 undergoes hyperphosphorylation by cyclin-dependent kinase (CDK) complexes during S phase, which leads to its functional inactivation. The T369 phosphorylation contributes to this regulatory mechanism, allowing for temporary suspension of RBL1's growth-suppressive functions during specific cell cycle phases. Methodologically, the ability to detect this specific phosphorylation state using antibodies like Phospho-RBL1 (T369) enables researchers to monitor the activation status of RBL1/p107 in various experimental conditions and cellular contexts .

• What are the biochemical properties of anti-Phospho-RBL1 (T369) antibodies?

  Anti-Phospho-RBL1 (T369) antibodies are typically rabbit polyclonal antibodies designed to specifically recognize RBL1/p107 only when phosphorylated at the Threonine 369 residue. These antibodies have a high degree of specificity, allowing them to detect endogenous levels of phosphorylated RBL1 without cross-reactivity to unphosphorylated forms. The immunogen used for generating these antibodies is commonly a synthetic peptide derived from human RBL1 surrounding the phosphorylation site of Thr369 (approximately amino acids 335-384). The antibodies are generally purified from rabbit serum through antigen affinity chromatography using the immunizing phospho-peptide. They are supplied in a liquid formulation containing Phosphate Buffered Saline (without Mg²⁺ and Ca²⁺), pH 7.4, with 150mM NaCl, 0.02% Sodium Azide, and 50% Glycerol to maintain stability. The antibodies detect a protein with an approximate molecular weight of 120kDa .

Applications and Methodology

• What are the validated applications for Phospho-RBL1 (T369) antibodies?

  Phospho-RBL1 (T369) antibodies have been validated for several key research applications:

  1. Immunohistochemistry (IHC): These antibodies can be used at dilutions of 1:50-1:100 to detect phosphorylated RBL1 in tissue sections, allowing for spatial analysis of RBL1 phosphorylation patterns in different cell types and tissues.

  2. Enzyme-Linked Immunosorbent Assay (ELISA): For quantitative assessment of phosphorylated RBL1 levels, these antibodies can be used at approximately 1:5000 dilution in ELISA-based assays.

  The antibodies demonstrate cross-reactivity with both human and mouse RBL1, making them suitable for comparative studies across these species. While not explicitly validated in the provided information, these phospho-specific antibodies may potentially be adapted for other applications such as Western blotting, immunoprecipitation, or chromatin immunoprecipitation, though optimization would be required .

• What are the recommended protocols for using Phospho-RBL1 (T369) antibodies in immunohistochemistry?

  For optimal immunohistochemical detection of phosphorylated RBL1 at T369, researchers should follow these methodological considerations:

  1. Tissue Preparation: Standard formalin fixation and paraffin embedding protocols are suitable, with attention to fixation time to preserve phospho-epitopes.

  2. Antigen Retrieval: Heat-induced epitope retrieval using citrate buffer (pH 6.0) is typically recommended for phospho-epitopes.

  3. Antibody Dilution: Use the Phospho-RBL1 (T369) antibody at a dilution range of 1:50-1:100 in an appropriate antibody diluent.

  4. Incubation Conditions: Overnight incubation at 4°C generally provides optimal signal-to-noise ratio.

  5. Detection System: Use an appropriate secondary antibody system, such as Goat Anti-Rabbit IgG H&L conjugated to HRP, biotin, fluorescent tags, or AP depending on the desired detection method.

  6. Controls: Always include phosphatase-treated negative controls to validate phospho-specificity and appropriate isotype controls (Rabbit IgG).

  7. Counterstaining: Use appropriate nuclear counterstains like hematoxylin for brightfield or DAPI for fluorescent detection.

  Researcher should optimize conditions for their specific tissue and experimental design, as phospho-epitopes can be particularly sensitive to variations in sample handling and processing .

• How should Phospho-RBL1 (T369) antibodies be stored and handled to maintain activity?

  To maintain optimal antibody activity and specificity, follow these storage and handling guidelines:

  1. Long-term Storage: Store the antibody at -20°C for up to one year. Aliquoting upon first use is recommended to minimize freeze-thaw cycles.

  2. Short-term Storage: For frequent use within a month, storing at 4°C is acceptable.

  3. Avoid Freeze-Thaw Cycles: Repeated freezing and thawing can degrade antibody quality and should be minimized.

  4. Handling During Experiments: Keep the antibody on ice when in use and return to appropriate storage promptly.

  5. Dilution Stability: Once diluted in working buffer, use the antibody within 24 hours for optimal performance.

  6. Shipping Conditions: These antibodies are typically shipped at 4°C but should be transferred to -20°C storage upon arrival for long-term stability.

  Adhering to these guidelines ensures maintenance of antibody specificity and sensitivity, particularly important for phospho-specific antibodies which can be more sensitive to storage conditions than antibodies targeting total protein .

Experimental Design Considerations

• How can researchers validate the specificity of Phospho-RBL1 (T369) antibody signals?

  Validating phospho-specific antibody signals is crucial for experimental rigor. Implement these methodological approaches:

  1. Phosphatase Treatment Controls: Treat duplicate samples with lambda phosphatase before immunodetection. Loss of signal confirms phospho-specificity.

  2. Genetic Validation: Use CRISPR/Cas9-generated RBL1 knockout cells as negative controls. The methodology for generating such controls has been described using strategies like targeting RBL1 exon 1 with specific sgRNA sequences (e.g., GAGGACAAGCCCCACGCTGA) in lentiviral vectors.

  3. Phosphorylation Site Mutants: Express RBL1 with T369A mutations that cannot be phosphorylated at this site. Absence of signal with the mutant validates specificity.

  4. Cellular Context Validation: Compare signals in quiescent cells versus proliferating cells, as RBL1 phosphorylation levels should differ in these contexts.

  5. Treatment with Kinase Inhibitors: Use inhibitors of CDKs or other kinases involved in RBL1 phosphorylation and observe decreased signal.

  6. Peptide Competition: Pre-incubate the antibody with the phospho-peptide immunogen to block specific binding sites. This should eliminate specific signals.

  7. Cross-Validation with Other Methods: Where possible, verify phosphorylation status using mass spectrometry or alternative phospho-specific antibodies targeting nearby phosphorylation sites.

  These validation methods should be reported alongside experimental results to substantiate the specificity of observed signals .

• What cell culture and treatment conditions are optimal for studying RBL1 T369 phosphorylation?

  To effectively study RBL1 T369 phosphorylation, consider these methodological approaches for cell culture and treatments:

  1. Cell Line Selection: Use model cell lines with well-characterized RBL1 expression, such as A549 or MSTO-211H cells, which have been established for RBL1 studies. Culture these in appropriate media (DMEM for A549, RPMI for MSTO-211H) supplemented with 10% FBS and 1% L-glutamine.

  2. Cell Cycle Synchronization: Since RBL1 phosphorylation varies throughout the cell cycle, synchronize cells using standard methods (serum starvation, double thymidine block, or nocodazole treatment) to obtain populations enriched in specific cell cycle phases.

  3. Growth Factor Stimulation: Treat serum-starved cells with growth factors like EGF or IGF2 to induce signaling cascades that lead to RBL1 phosphorylation. These factors have been used at standardized concentrations to study RBL1 regulation.

  4. Kinase Modulation: Manipulate activities of kinases that phosphorylate RBL1 using specific inhibitors. For example, AKT inhibitors like AKTi VIII can be used to study AKT's role in RBL1 phosphorylation.

  5. Phosphatase Inhibition: Use phosphatase inhibitors during cell lysis to preserve phosphorylation status. Standard protocols include RIPA buffer supplemented with phosphatase inhibitor cocktails.

  6. Subcellular Fractionation: To study compartment-specific phosphorylation patterns, separate nuclear and cytoplasmic fractions using established reagents like NE-PER extraction kit.

  7. Time-Course Analysis: Following stimulation, collect cells at multiple time points to capture dynamic changes in phosphorylation status.

  These conditions provide a methodological framework for studying RBL1 T369 phosphorylation in controlled experimental settings .

• How can researchers differentiate between the functions of phosphorylated RBL1 at T369 versus other phosphorylation sites?

  Differentiating the specific functions of T369 phosphorylation from other RBL1 phosphorylation sites requires sophisticated experimental approaches:

  1. Site-Specific Mutagenesis: Generate RBL1 constructs with point mutations at T369 (T369A to prevent phosphorylation or T369E to mimic constitutive phosphorylation) while keeping other sites intact. Express these using lentiviral systems similar to those described for CDK6 expression studies.

  2. Phospho-site Specific Antibody Panels: Use antibodies targeting different phosphorylation sites of RBL1 (e.g., Ser975 as mentioned in the literature) alongside the T369 antibody to create a comprehensive phosphorylation profile.

  3. Temporal Analysis: Map the sequence of phosphorylation events at different sites during cell cycle progression using synchronized cell populations and time-course experiments.

  4. Kinase Specificity Analysis: Identify kinases responsible for phosphorylating T369 versus other sites using specific kinase inhibitors or kinase knockdown approaches.

  5. Protein-Protein Interaction Studies: Compare interactomes of RBL1 with different phosphorylation states using co-immunoprecipitation coupled with mass spectrometry.

  6. Functional Readouts: Assess cellular outcomes (proliferation, gene expression, etc.) with site-specific phospho-mutants to attribute functional consequences to specific phosphorylation events.

  7. Computational Modeling: Use structural modeling to predict how T369 phosphorylation might uniquely affect protein conformation compared to modifications at other sites.

  These approaches allow researchers to systematically isolate the specific contributions of T369 phosphorylation to RBL1 function .

Advanced Research Questions and Troubleshooting

• What signaling pathways regulate RBL1 phosphorylation at T369 and how can they be manipulated experimentally?

  RBL1 phosphorylation is regulated by multiple signaling cascades that can be experimentally manipulated:

  Signaling Pathway	Experimental Manipulation Strategy	Expected Effect on T369 Phosphorylation
  AKT pathway	Treatment with AKT inhibitor (AKTi VIII)	Decreased phosphorylation if AKT-dependent
  MAPK/ERK pathway	MEK inhibitors (U0126, PD98059)	Altered phosphorylation if ERK-dependent
  Growth factor signaling	EGF or IGF2 stimulation	Increased phosphorylation through downstream kinases
  CDK-Cyclin complexes	CDK inhibitors or Cyclin D1/D3 manipulation	Reduced phosphorylation (primary kinases for RBL1)
  CaMK signaling	CaMKII inhibition or expression modulation	Altered phosphorylation if CaMK-dependent

  Methodological approaches include:

  1. Pathway Inhibition: Treat cells with specific inhibitors of signaling components at standardized concentrations and durations.

  2. Genetic Manipulation: Use CRISPR/Cas9-based knockout strategies or overexpression of pathway components using lentiviral vectors.

  3. Combined Treatments: Apply multiple pathway modulators to identify cross-talk mechanisms affecting RBL1 phosphorylation.

  4. Temporal Analysis: Monitor phosphorylation dynamics following pathway stimulation or inhibition over time courses.

  These experimental approaches allow researchers to delineate the upstream regulators of RBL1 T369 phosphorylation and their interconnections .

• How does RBL1 T369 phosphorylation status change during cell cycle progression?

  RBL1 T369 phosphorylation demonstrates dynamic patterns during cell cycle progression that can be methodically analyzed:

  1. Cell Synchronization and Time-Course Analysis: To track phosphorylation changes across the cell cycle, researchers should:

     • Synchronize cells using established methods (serum starvation, double thymidine block, etc.)

     • Release cells from synchronization and collect at defined intervals

     • Perform parallel analysis of phospho-RBL1 (T369) levels and cell cycle distribution

  2. Cell Cycle Phase Correlation: Utilize flow cytometry with propidium iodide staining (as described in the literature) to determine cell cycle phase distribution alongside Western blotting for phospho-RBL1.

  3. Expected Pattern: Based on known RBL1 regulation:

     • Low phosphorylation in G0/early G1 (when RBL1 is active as a repressor)

     • Increasing phosphorylation through late G1 and into S phase

     • Hyperphosphorylation maintained through S phase (when RBL1 is functionally inactivated)

     • Potential dephosphorylation during mitotic exit

  4. Single-Cell Analysis: For heterogeneous populations, combine immunofluorescence for phospho-RBL1 (T369) with cell cycle markers to correlate phosphorylation status with cell cycle position at the single-cell level.

  5. Mathematical Modeling: Develop quantitative models of RBL1 phosphorylation dynamics throughout the cell cycle based on experimental data.

  These approaches provide a comprehensive view of how T369 phosphorylation changes throughout cell cycle progression, contributing to our understanding of RBL1's regulatory mechanisms .

• What are the most common technical challenges when working with Phospho-RBL1 (T369) antibodies and how can they be addressed?

  Researchers frequently encounter these technical challenges when working with phospho-specific antibodies like anti-Phospho-RBL1 (T369):

  1. Phospho-Epitope Instability:

     • Challenge: Phosphorylated residues can be rapidly lost due to endogenous phosphatase activity.

     • Solution: Add phosphatase inhibitors (e.g., halt protease and phosphatase inhibitor cocktail) to all buffers from sample collection through processing. Keep samples cold at all times.

  2. Signal Specificity Issues:

     • Challenge: Distinguishing specific phospho-signal from background.

     • Solution: Always include phosphatase-treated controls and implement validation methods described in FAQ #7. Use blocking peptides specific to the phosphorylated epitope to confirm signal specificity.

  3. Fixation-Induced Epitope Masking:

     • Challenge: Formalin fixation can mask phospho-epitopes in IHC applications.

     • Solution: Optimize antigen retrieval methods specifically for phospho-epitopes, often requiring stronger conditions than for total protein detection.

  4. Antibody Cross-Reactivity:

     • Challenge: Potential recognition of similar phosphorylated motifs on other proteins.

     • Solution: Validate in knockout systems. Use multiple antibodies targeting different epitopes of the same protein for confirmation.

  5. Low Signal-to-Noise Ratio:

     • Challenge: High background obscuring specific signals.

     • Solution: Optimize blocking conditions, antibody dilutions, and incubation times. Consider using more sensitive detection systems or signal amplification methods.

  6. Batch-to-Batch Variability:

     • Challenge: Inconsistent results with different antibody lots.

     • Solution: Maintain reference samples with known phosphorylation status to validate new antibody lots. Consider pooling validated lots for long-term studies.

  7. Context-Dependent Phosphorylation:

     • Challenge: Phosphorylation levels may vary dramatically with cellular conditions.

     • Solution: Carefully control experimental conditions and include appropriate positive controls where phosphorylation is expected to be high (e.g., proliferating cells for cell cycle-regulated phosphorylation).

  Addressing these challenges requires rigorous validation and optimization specific to each experimental system .

• How can researchers integrate RBL1 T369 phosphorylation data with broader cell cycle and tumor suppressor pathway analyses?

  Integrating RBL1 T369 phosphorylation data into broader analytical frameworks requires multi-dimensional approaches:

  1. Multi-Protein Phosphorylation Profiling: Simultaneously analyze phosphorylation status of RBL1 T369 alongside:

     • Other RB family members (RB1/p105, RBL2/p130)

     • Other phosphorylation sites on RBL1 (e.g., Ser975)

     • E2F transcription factors and CDK-cyclin complexes

  2. Transcriptomic Analysis Correlation:

     • Perform RNA-seq or RT-PCR (using methods described in the literature) to correlate RBL1 phosphorylation status with expression of:

       • E2F target genes

       • Cell cycle regulators

       • Other tumor suppressor pathways

  3. Functional Pathway Analysis:

     • Cell cycle analysis using propidium iodide staining and flow cytometry

     • Proliferation assays

     • Senescence markers

     • Apoptosis indicators

  4. Computational Integration:

     • Use pathway analysis tools to map relationships between RBL1 phosphorylation and other cellular processes

     • Develop predictive models correlating RBL1 phosphorylation with cellular outcomes

  5. Context-Specific Studies:

     • Compare RBL1 phosphorylation patterns and consequences across:

       • Normal versus tumor tissues

       • Different cancer types

       • Drug-sensitive versus resistant cell populations

  6. Protein-Protein Interaction Network Analysis:

     • Identify phosphorylation-dependent interactors using techniques like:

       • Co-immunoprecipitation followed by mass spectrometry

       • Proximity labeling methods

       • Fluorescence resonance energy transfer (FRET)

  This multi-faceted approach positions RBL1 T369 phosphorylation within its broader functional context in cellular regulation and disease processes .

• What are the emerging techniques for studying site-specific phosphorylation of RBL1 beyond traditional antibody-based methods?

  Advanced technologies beyond traditional antibody-based detection offer new insights into RBL1 phosphorylation:

  1. Mass Spectrometry-Based Approaches:

     • Phosphoproteomics: Global analysis of phosphorylation events using enrichment strategies (TiO₂, IMAC) followed by LC-MS/MS

     • Targeted MS: Multiple reaction monitoring (MRM) or parallel reaction monitoring (PRM) for quantitative analysis of specific phosphopeptides

     • Absolute Quantification: Use of isotopically labeled synthetic phosphopeptides as internal standards

  2. Proximity-Based Detection Methods:

     • Proximity Ligation Assay (PLA): Detection of phospho-RBL1 in situ with single-molecule sensitivity

     • BioID or TurboID: Mapping phosphorylation-dependent protein interactions in living cells

  3. Live-Cell Phosphorylation Sensors:

     • FRET-Based Sensors: Genetically encoded reporters for real-time monitoring of RBL1 phosphorylation dynamics

     • Bimolecular Fluorescence Complementation: Visualization of phosphorylation-dependent interactions

  4. CRISPR-Based Technologies:

     • Base Editing: Precise modification of phosphorylation sites without double-strand breaks

     • CUT&RUN/CUT&Tag: Mapping chromatin associations of phosphorylated RBL1 with high resolution

  5. Structural Biology Approaches:

     • Hydrogen-Deuterium Exchange MS: Analyzing structural changes induced by phosphorylation

     • Cryo-EM: Visualizing conformational states of phosphorylated versus unphosphorylated RBL1

  6. Single-Cell Technologies:

     • Single-Cell Phosphoproteomics: Analyzing cell-to-cell variation in RBL1 phosphorylation

     • Mass Cytometry (CyTOF): Multiparameter analysis of phosphorylation in heterogeneous populations

  7. Computational Methods:

     • Machine Learning Algorithms: Predicting phosphorylation effects from protein sequence and structure

     • Molecular Dynamics Simulations: Modeling the conformational consequences of T369 phosphorylation

  These emerging technologies complement antibody-based methods, providing deeper insights into the functional significance of site-specific RBL1 phosphorylation .