Phospho-STK11 (S334) Antibody

Shipped with Ice Packs
In Stock

Description

Fundamental Characteristics of Phospho-STK11 (S334) Antibody

Phospho-STK11 (S334) Antibody is a specialized immunological reagent designed to recognize and bind specifically to the serine/threonine kinase STK11 (also known as LKB1) when phosphorylated at serine residue 334. This antibody serves as a valuable tool for researchers studying the post-translational modifications of STK11, a critical tumor suppressor protein that regulates cell growth and metabolism . The antibody enables detection and analysis of phosphorylated STK11 in various cell types, providing insights into its regulation and function in both normal physiological processes and disease states .

Most commercial versions of this antibody are developed in rabbits as polyclonal antibodies, generated using synthetic phosphopeptides corresponding to the region surrounding serine 334 of human STK11 . The high specificity of these antibodies ensures they detect endogenous STK11 only when phosphorylated at serine 334, making them reliable tools for monitoring this specific post-translational modification .

Key Technical Properties

The table below summarizes the standard specifications of Phospho-STK11 (S334) antibodies available from major suppliers:

PropertySpecification
Host SpeciesRabbit
ClonalityPolyclonal
IsotypeIgG
Species ReactivityHuman, Mouse, Rat
ImmunogenSynthetic phosphorylated peptide around S334 of human STK11
Observed Molecular Weight54 kDa
Calculated Molecular Weight45-49 kDa
Storage BufferPBS with 0.02% sodium azide, 50% glycerol, pH 7.3
Storage Conditions-20°C (long-term), 4°C (up to three months)
ApplicationsWestern Blot, ELISA, Immunohistochemistry

The antibody is typically supplied in liquid form and should be stored at -20°C for long-term preservation, with aliquoting recommended to avoid repeated freeze-thaw cycles . When properly stored, the antibody maintains its reactivity and specificity for up to one year .

Recommended Working Dilutions

Different experimental applications require specific antibody dilutions for optimal results:

ApplicationRecommended Dilution Range
Western Blot1:500 - 1:2000
Immunohistochemistry1:50 - 1:100
ELISA1:4000

These recommended dilutions serve as starting points, and researchers should optimize concentrations based on their specific experimental conditions and sample types .

Structure and Function of STK11 Protein

Understanding the STK11 protein's structure and function provides essential context for appreciating the significance of phosphorylation at serine 334 and the utility of antibodies targeting this modification.

Protein Structure and Domains

STK11 (Serine/Threonine Kinase 11), also known as LKB1, is a 433-amino acid protein with a calculated molecular weight of approximately 48 kDa, though it typically appears as a 54 kDa band on Western blots due to post-translational modifications . The protein consists of three primary regions:

  1. N-terminal region (amino acids 1-43)

  2. Serine-threonine kinase domain (amino acids 44-309)

  3. C-terminal region (amino acids 310-433)

The C-terminal region contains multiple motifs that serve as targets for post-translational modifications, including the serine 334 residue that is the focus of phospho-specific antibodies . The N-terminal region contains a nuclear localization signal that regulates the protein's subcellular distribution .

Biological Functions

STK11 functions as a master kinase and tumor suppressor, regulating multiple cellular processes through its catalytic activity . Its primary functions include:

  1. Regulating cell polarity and energy metabolism

  2. Controlling the activity of AMP-activated protein kinase (AMPK) family members

  3. Participating in cell cycle regulation and apoptosis

  4. Contributing to DNA damage response pathways

  5. Maintaining epithelial cell polarity through cytoskeletal regulation

STK11 achieves these diverse functions through phosphorylation of multiple downstream targets, including AMPK catalytic subunits PRKAA1 and PRKAA2, as well as other AMPK-related kinases such as BRSK1, BRSK2, MARK1-4, and several others .

Association with Disease

Mutations in the STK11 gene have been associated with Peutz-Jeghers syndrome, an autosomal dominant disorder characterized by gastrointestinal polyps, pigmented macules on the skin and mouth, and increased risk for various neoplasms . Beyond this syndrome, dysregulation of STK11 has been implicated in multiple cancer types, emphasizing the protein's crucial role as a tumor suppressor .

Significance of S334 Phosphorylation

The phosphorylation of STK11 at serine 334 represents a critical regulatory mechanism that modulates the protein's function, localization, and interactions with other cellular components.

Regulatory Mechanism

Phosphorylation at serine 334 significantly impacts STK11's functional properties in several ways:

  1. It promotes STK11 binding to 14-3-3 proteins, which are key regulatory molecules that mediate signal transduction by binding to phosphoserine-containing proteins .

  2. It decreases STK11's association with STE-20-related kinase adaptor protein (STRAD), an important interaction partner that allosterically activates STK11 .

  3. It influences STK11's subcellular localization, potentially increasing its nuclear presence .

These effects collectively contribute to the regulation of STK11's catalytic activity and its participation in various signaling pathways.

Induction and Regulation

Research has demonstrated that STK11 phosphorylation at serine 334 can be induced by various stimuli, including:

  1. Ultraviolet (UV) radiation exposure

  2. Treatment with phorbol 12-myristate 13-acetate (PMA)

  3. Serum starvation conditions

These findings indicate that S334 phosphorylation responds to cellular stress conditions and may play a role in stress response pathways . The regulation of this phosphorylation event involves complex signaling networks that remain an active area of investigation.

Experimental Applications

Phospho-STK11 (S334) antibodies serve as versatile tools for investigating STK11 biology across multiple experimental platforms.

Western Blot Analysis

Western blotting represents the most common application for these antibodies, enabling detection and semi-quantitative analysis of S334-phosphorylated STK11 in cell and tissue lysates . This technique allows researchers to:

  1. Monitor changes in STK11 phosphorylation status in response to various stimuli

  2. Compare phosphorylation levels across different cell types or tissues

  3. Assess the effects of drugs or genetic manipulations on STK11 regulation

For optimal results in Western blot applications, cell lysates should be prepared after appropriate treatments that induce STK11 phosphorylation, such as UV exposure or PMA treatment .

Immunohistochemistry

Phospho-STK11 (S334) antibodies can be used for immunohistochemical analysis of formalin-fixed, paraffin-embedded tissue sections . This application provides insights into:

  1. The tissue distribution of phosphorylated STK11

  2. Changes in phosphorylation patterns in disease states

  3. Subcellular localization of phosphorylated STK11 in intact tissues

Immunohistochemical analysis has been successfully demonstrated in human lung carcinoma tissue, revealing patterns of STK11 phosphorylation that may contribute to understanding its role in cancer biology .

ELISA Applications

Enzyme-linked immunosorbent assays utilizing Phospho-STK11 (S334) antibodies provide a quantitative approach to measuring phosphorylated STK11 levels in cell or tissue lysates . This method offers advantages for high-throughput screening and precise quantification of phosphorylation changes.

STK11 in Cell Signaling Networks

STK11 operates within complex cellular signaling networks, with its phosphorylation at serine 334 representing one of several regulatory mechanisms that modulate its function.

The STK11-STRAD-MO25 Complex

STK11's full activation requires its association with two regulatory proteins: STE-20-related kinase adaptor protein (STRAD) and Mouse protein 25 (MO25) . This heterotrimeric complex formation significantly enhances STK11's catalytic activity and promotes its cytoplasmic localization. Phosphorylation at serine 334 influences this complex formation by potentially decreasing STK11's association with STRAD, thereby modulating STK11 activity .

Interplay with Other Phosphorylation Sites

STK11 contains multiple phosphorylation sites that collectively regulate its function. Besides serine 334, other important phosphorylation sites include:

  1. Threonine 336 - adjacent to serine 334, suggesting potential coordinated regulation

  2. Threonine 363 - phosphorylated by ATM following ionizing radiation

  3. Serine 428 - phosphorylated by various kinases including RPS6KA5, RPS6KB1, RPS6KA3, and PRKACA

  4. Serine 399 - phosphorylated by PRKCZ (protein kinase C zeta)

The interplay between these various phosphorylation events creates a sophisticated regulatory network that fine-tunes STK11 function in response to diverse cellular signals .

Research Applications and Future Directions

The continued development and application of Phospho-STK11 (S334) antibodies hold significant promise for advancing our understanding of STK11 biology and its implications in health and disease.

Current Research Applications

These antibodies currently contribute to research in several domains:

  1. Cancer biology - investigating STK11's role as a tumor suppressor and how its phosphorylation status affects this function

  2. Metabolic disorders - examining the STK11-AMPK axis in cellular energy sensing and metabolic regulation

  3. Cell polarity studies - elucidating how STK11 phosphorylation impacts its control of cell polarity

  4. Drug discovery - evaluating potential therapeutic agents targeting STK11 regulatory pathways

Future Research Directions

Several promising avenues for future research utilizing Phospho-STK11 (S334) antibodies include:

  1. Development of phosphorylation-specific biomarkers for disease diagnosis or prognosis

  2. Integration with proteomics approaches to map the complete STK11 interactome

  3. Investigation of pharmacological modulators of STK11 phosphorylation for therapeutic applications

  4. Exploration of tissue-specific regulation of STK11 phosphorylation in development and disease

These directions highlight the continuing relevance of Phospho-STK11 (S334) antibodies in advancing our understanding of fundamental biological processes and their dysregulation in disease states.

Product Specs

Buffer
Liquid in PBS containing 50% glycerol, 0.5% BSA, and 0.02% sodium azide.
Form
Liquid
Lead Time
Typically, we can ship products within 1-3 business days of receiving your order. Delivery times may vary depending on the purchasing method or location. Please consult your local distributors for specific delivery time estimates.
Synonyms
hLKB1 antibody; Liver kinase B1 antibody; LKB1 antibody; PJS antibody; Polarization related protein LKB1 antibody; Renal carcinoma antigen NY-REN-19 antibody; Serine/Threonine Kinase 11 antibody; Serine/threonine protein kinase 11 antibody; Serine/threonine protein kinase LKB1 antibody; Serine/threonine protein kinase STK11 antibody; Serine/threonine-protein kinase 11 antibody; Serine/threonine-protein kinase LKB1 antibody; Serine/threonine-protein kinase XEEK1 antibody; Stk11 antibody; STK11_HUMAN antibody
Target Names
Uniprot No.

Target Background

Function
Phospho-STK11 (S334) Antibody targets a tumor suppressor serine/threonine-protein kinase that plays a critical role in regulating the activity of AMP-activated protein kinase (AMPK) family members. This regulation is essential for a variety of cellular processes, including metabolism, polarity, apoptosis, and DNA damage response.

This kinase specifically phosphorylates the T-loop of AMPK family proteins, thereby activating them. It also phosphorylates non-AMPK family proteins such as STRADA, PTEN, and possibly p53/TP53.

As a key upstream regulator of AMPK, STK11 mediates phosphorylation and activation of AMPK catalytic subunits PRKAA1 and PRKAA2, thereby influencing processes such as:

* Inhibition of signaling pathways that promote cell growth and proliferation under energy-deficient conditions.
* Maintenance of glucose homeostasis in the liver.
* Activation of autophagy when cells are deprived of nutrients.
* B-cell differentiation within the germinal center in response to DNA damage.

STK11 also acts as a regulator of cellular polarity by modulating the actin cytoskeleton. It is crucial for cortical neuron polarization by mediating phosphorylation and activation of BRSK1 and BRSK2, leading to axon initiation and specification.

In the context of DNA damage response, STK11 interacts with p53/TP53 and is recruited to the CDKN1A/WAF1 promoter to participate in transcriptional activation. While it can phosphorylate p53/TP53, the significance of this action in vivo is unclear. This phosphorylation may be indirect and mediated by downstream STK11/LKB1 kinase NUAK1.

STK11 further acts as a mediator of p53/TP53-dependent apoptosis through interaction with p53/TP53. It translocates to the mitochondrion during apoptosis and regulates p53/TP53-dependent apoptotic pathways. It also regulates UV radiation-induced DNA damage response mediated by CDKN1A. In association with NUAK1, it phosphorylates CDKN1A in response to UV radiation, contributing to its degradation, which is essential for optimal DNA repair.

Notably, STK11 plays a role in spermiogenesis.
Gene References Into Functions
  1. WIPI3 and WIPI4 beta-propellers have roles as scaffolds for LKB1-AMPK-TSC signaling circuits in the control of autophagy PMID: 28561066
  2. The function of human LKB1 depends on membrane binding. LKB1 is down-regulated in malignant melanoma. PMID: 28649994
  3. LKB1 expression was abnormally reduced in >80% of gallbladder carcinoma (GBC) tissues, and that the downregulation of LKB1 mRNA expression was associated with the poor prognosis of patients with GBC. PMID: 30015925
  4. Low LKB1 expression is associated with prostate cancer. PMID: 29566997
  5. Decreases in LKB1 expression by HBx protein-mediated p53 inactivation may play an important role in HBV-associated hepatocellular tumorigenesis. PMID: 29475611
  6. LKB1 performed as a tumor suppressor in lung cancer inhibiting proliferation of lung cancer cells and inducing their apoptosis. LKB1 also inhibited the in vivo growth of lung cancer. After treatment with cyclopamine, the activated Shh signaling pathway induced by LKB1 silencing was suppressed, and the inactivated Shh signaling pathway induced by LKB1 over-expression was enhanced. PMID: 29573522
  7. Cytoplasmic LKB1 promotes the growth of lung adenocarcinoma and could be a prognostic marker for lung adenocarcinoma. PMID: 30033530
  8. Here we report a novel frameshift mutation of STK11 in a Chinese Peutz-Jeghers syndrome family. PMID: 29301733
  9. findings demonstrate that LKB1 plays an important role in the maintenance of LSCs, which may be responsible for drug resistance and AML relapse PMID: 28397012
  10. STK11 mutation found in duodenal adenomas/adenocarcinoma highlight the importance of proteins encoded by these genes in tumor development. PMID: 29525853
  11. Study revealed a new role for LKB1 in promoting cell motility by downregulating migration-suppressing miRNA expression and exosome secretion. PMID: 29138862
  12. In our cohort enriched for advanced NSCLC patients who received platinum-based chemotherapy, STK11 mutations were not specifically associated with clinico-pathological features and they did not impact upon survival. PMID: 29191602
  13. Study found that ablation of Lkb1 in adipocytes induced inflammation and macrophage invasion in sciatic nerves, leading to severe sciatic axon abnormality and hindlimb paralysis. PMID: 29032027
  14. Data indicate that LKB1 is a potential suppressor of metastasis of pancreatic ductal carcinoma (PDC). Furthermore, results demonstrate that LKB1 promotes Snail protein degradation though enhancing interaction between E3 ligase FBXL14 and Snail to increase Snail ubiquitination. PMID: 29601127
  15. Ex vivo models showed that MDA-MB-231, a mesenchymal tumor cell line, grew in suspension only if LKB1 was upregulated, but the MCF-7 epithelial cell line lost its ability to generate spheroids and colonies when LKB1 was inhibited, supporting the idea that LKB1 might be necessary for circulating tumor cells to overcome the absence of the extracellular matrix during the early phases of intravasation. PMID: 28700115
  16. we speculate that YAP/TAZ in dependent of FOS may promote DNMT1 and subsequently mediate DNMT1-G9A complex involving serine metabolism and the methylation of DNA and histone. We hope that our study will stimulate further studies and a new targeted therapy and early medical intervention for YAP/TAZ could be a useful option for breast cancer cases complicated with LKB1 deficiency. PMID: 28931725
  17. Results show that STK11 mutation is a biomarker for responsiveness to cardiac glycosides (CGs). PMID: 27431571
  18. Data suggest that the hereditary Peutz-Jeghers syndrome (PJS) in the family may be attributed to the serine/threonine kinase 11 (STK11) gene missense mutation detected in both daughter and mother. PMID: 29419869
  19. LKB1 expression promoted an adaptive response to energy stress induced by anchorage-independent growth. Finally, this diminished adaptability sensitized LKB1-deficient cells to combinatorial inhibition of mitochondrial complex I and glutaminase. PMID: 28034771
  20. these data uncover that ADIPOQ/adiponectin induces autophagic cell death in breast cancer and provide in vitro and in vivo evidence for the integral role of STK11/LKB1-AMPK-ULK1 axis in ADIPOQ/adiponectin-mediated cytotoxic autophagy. PMID: 28696138
  21. Our data hint at a possible predictive impact of LKB1 expression in patients with aNSCLC treated with chemotherapy plus bevacizumab. PMID: 28119362
  22. Our results indicate that LKB1 Phe354Leu polymorphism may play an important role in leukemogenesis and represents a poor prognostic factor. PMID: 28882949
  23. we have demonstrated a novel function of LKB1 in DNA damage response. Cancer cells lacking LKB1 are more susceptible to DNA damage-based therapy and, in particular, to drugs that further impair DNA repair, such as PARP inhibitors. PMID: 27705915
  24. LKB1 overexpression inhibited apoptosis and activated autophagy of Eca109 cells following radiation treatment, as determined by flow cytometry and western blot analyses. PMID: 28656285
  25. In this study, compound heterozygous variants of LKB1, c.890G > A/ c.1062C > G and del(exon1)/ c.1062C > G, were identified in two sporadic Chinese Peutz-Jeghers syndrome cases PMID: 28185117
  26. By downregulating acetylated LKB1 protein via HERC2, SIRT1 fine-tunes the crosstalk between endothelial and vascular smooth muscle cells to prevent adverse arterial remodeling and maintain vascular homeostasis PMID: 27259994
  27. Data indicate that nesfatin-1/NUCB-2 enhanced migration, invasion and epithelial-mesenchymal transition (EMT) in colon cancer cells through LKB1/AMPK/TORC1/ZEB1 pathways in vitro and in vivo. PMID: 27150059
  28. STK11 sequence deletions and point mutations were found in 11 Chinese children with Peutz-Jeghers syndrome. PMID: 27467201
  29. define a CIII-PI3K-regulated endosomal signalling platform from which LKB1 directs epithelial polarity, the dysregulation of which endows LKB1 with tumour-promoting properties PMID: 29084199
  30. Structure of the complex of phosphorylated liver kinase B1 and 14-3-3zeta has been reported. PMID: 28368277
  31. a novel de-novo germline mutation is associated with Peutz-Jeghers syndrome and elevated cancer risk PMID: 29141581
  32. STK11 mutation is associated with Lung Adenocarcinoma. PMID: 26917230
  33. Case Report: novel heterozygous mutation (c.426-448delCGTGCCGGAGAAGCGTTTCCCAG,p.S142SfsX13) in the STK11 gene causing PJS in a Chinese female without a Peutz-Jeghers syndrome family history. PMID: 28986664
  34. Low LKB1 expression is associated with non-small cell lung cancer. PMID: 28652249
  35. Macrophage LKB1 reduction caused by oxidized low-density lipoprotein promotes foam cell formation and the progression of atherosclerosis. PMID: 28827412
  36. CPS1 maintains pyrimidine pools and DNA synthesis in KRAS/LKB1-mutant lung cancer cells PMID: 28538732
  37. All together our results show that STK11ex1-2 mutations delineate an aggressive subtype of lung cancer for which a targeted treatment through STK11 inhibition might offer new opportunities. PMID: 26625312
  38. Low LKB1 expression is associated with HPV-associated cervical cancer progression. PMID: 27546620
  39. Mutations in TP53 and STK11 also impacted tumor biology regardless of KRAS status, with TP53 strongly associated with enhanced proliferation and STK11 with suppression of immune surveillance. These findings illustrate the remarkably distinct ways through which tumor suppressor mutations may contribute to heterogeneity in KRAS-mutant tumor biology. PMID: 26477306
  40. Studies indicate that the serine-threonine kinase 11 (Peutz-Jeghers syndrome) LKB1 gene is somatically mutated in female reproductive tract cancers. PMID: 27910069
  41. Our results indicate that HPV16 E6/E7 indirectly upregulated the expression of VEGF by inhibition of liver kinase B1 expression and upregulation of hypoxia-inducible factor 2alpha expression,thus propose a human papillomavirus-liver kinase B1-hypoxia-inducible factor 2A-vascular endothelial growth factor axis for the tumorigenesis of lung cancer PMID: 28720067
  42. The expression of LKB1 is down-regulated in most of the lung cell lines. PMID: 28031112
  43. Genetic variability at STK11 locus is associated with coronary artery disease risk in type 2 diabetes in the Chinese population. PMID: 28349069
  44. pregulation of PTEN and LKB1 in concert with negative or low levels of activated Akt, mTOR and S6 indicates that PI3K/Akt/mTOR pathway may not play a significant role in pathogenesis of leiomyoma. PMID: 27748285
  45. Data provide evidence for three novel mutations and three recurrent mutations in STK11 were identified in Chinese families with Peutz-Jeghers syndrome, which further broaden the mutation spectrum of STK11. PMID: 27821076
  46. The mutation detection rate for the LKB1 gene was 85.7% in our Chinese familial Peutz-Jeghers Syndrome and 63.2% in all Chinese Peutz-Jeghers Syndrome patients. The amplification and sequencing results of the flanking sequences presented 3 kinds of polymorphisms in introns of LKB1 gene: (c.374+24G>T, c.464+47_48inGGGGGCC, and c.920+7G>C). PMID: 27721366
  47. STK11 mutation in gastric in gastric-type endocervical adenocarcinoma is associated with worse prognosis. PMID: 27241107
  48. identification of a network linking metabolic and epigenetic alterations that is central to oncogenic transformation downstream of the liver kinase B1 (LKB1, also known as STK11) tumour suppressor, an integrator of nutrient availability, metabolism and growth PMID: 27799657
  49. Severely compromised endogenous LKB1 expression in the L02 cell line may confer to L02 cells tumor-initiating capacities. PMID: 27349837
  50. AMPK exerts multiple actions on TGF-beta signaling and supports that AMPK can serve as a therapeutic drug target for breast cancer PMID: 26718214

Show More

Hide All

Database Links

HGNC: 11389

OMIM: 175200

KEGG: hsa:6794

STRING: 9606.ENSP00000324856

UniGene: Hs.515005

Involvement In Disease
Peutz-Jeghers syndrome (PJS); Testicular germ cell tumor (TGCT)
Protein Families
Protein kinase superfamily, CAMK Ser/Thr protein kinase family, LKB1 subfamily
Subcellular Location
Nucleus. Cytoplasm. Membrane. Mitochondrion.; [Isoform 2]: Nucleus. Cytoplasm. Note=Predominantly nuclear, but translocates to the cytoplasm in response to metformin or peroxynitrite treatment.
Tissue Specificity
Ubiquitously expressed. Strongest expression in testis and fetal liver.

Q&A

How should researchers validate the specificity of Phospho-STK11 (S334) antibodies in different experimental systems?

Validation requires a multi-step approach:

  • Knockout/knockdown controls: Use CRISPR-modified cell lines lacking STK11 or S334 phosphorylation to confirm signal absence .

  • Peptide blocking assays: Pre-incubate antibodies with immunogen peptides (e.g., WRSMT sequence) . A ≥70% signal reduction in Western blot (WB) or immunohistochemistry (IHC) confirms specificity.

  • Orthogonal validation: Compare results with RNAi-mediated STK11 suppression or mass spectrometry data .

Table 1: Key Validation Parameters

ParameterWB CriteriaIHC CriteriaSource
Signal:Noise Ratio≥5:1Clear nuclear/cytoplasmic localization
Lot ConsistencyCV <15%Inter-slide CV <20%
Cross-reactivityNo bands in KO lysatesNegative tissue controls

What experimental conditions optimize Phospho-STK11 (S334) detection in energy metabolism studies?

  • Cell treatment: Use 2-deoxyglucose (10 mM, 2 hr) or AICAR (1 mM, 1 hr) to activate AMPK/LKB1 signaling .

  • Lysis buffers: Include PhosSTOP phosphatase inhibitors and 1% NP-40 to preserve phosphorylation .

  • Fixation: For IHC, 4% PFA with 0.1% Triton X-100 improves epitope accessibility .

How to address contradictory phosphorylation signals between WB and immunofluorescence (IF)?

  • Technical factors:

    • WB measures population averages; IF detects subcellular localization (nuclear vs. cytoplasmic) .

    • Optimize permeabilization: 0.2% saponin for membrane-bound epitopes vs. 0.1% Triton X-100 for nuclear targets .

  • Biological context:

    • S334 phosphorylation varies with cell cycle (G1/S transition) and metabolic state (fasted vs. fed) .

What strategies enable multiplexed detection of pS334-STK11 with downstream targets in single cells?

  • Sequential staining protocol:

    • pS334-STK11 IHC: Use HRP-conjugated antibody with DAB chromogen .

    • AMPK/ACC immunofluorescence: Apply Alexa Fluor 647/555 conjugates post-IHC .

    • Image alignment: Utilize multispectral imaging systems with <1 μm registration error.

  • Data normalization: Express pS334 levels relative to total STK11 (ΔF/F0) in ≥100 cells .

How to analyze phosphorylation dynamics at S334 under hypoxic vs. oxidative stress?

  • Time-course design:

    • Hypoxia: 1% O₂, 0-24 hr, sample every 2 hr .

    • Oxidative stress: 200 μM H₂O₂, 0-6 hr .

  • Kinetic modeling: Fit data to modified Hill equation:

    pS334Total STK11=VmaxtnKmn+tn\frac{pS334}{Total\ STK11} = \frac{V_{max} \cdot t^n}{K_m^n + t^n}

    Where nn = cooperativity coefficient (typically 1.2-2.1) .

Table 2: Phosphorylation Dynamics Under Stress

Conditiont₁/₂ (min)Max Phosphorylation (%)Source
Hypoxia45 ± 1268 ± 8
H₂O₂22 ± 682 ± 11

What computational tools resolve conflicting pS334 data from phosphoproteomics vs. antibody-based assays?

  • Phosphosite alignment: Map MS/MS spectra (e.g., PhosphoSitePlus) to antibody epitope (residues 300-349) .

  • Machine learning: Train Random Forest classifiers on:

    • Antibody cross-reactivity scores (STRING DB)

    • MS spectral counts (≥2 unique peptides)

  • Experimental arbitration: Perform immunoprecipitation with pS334 antibody followed by LC-MS/MS .

How to design controls for STK11 phosphorylation studies in Peutz-Jeghers syndrome models?

  • Genetic controls:

    • CRISPR knock-in of S334A mutation

    • Patient-derived fibroblasts with confirmed STK11 mutations

  • Pharmacological inhibitors:

    • 10 μM STO-609 (CaMKKβ inhibitor) to isolate LKB1-specific effects

    • 100 nM dorsomorphin (AMPK inhibitor) for pathway epistasis

What metrics distinguish artifact vs. biologically significant pS334 staining in tumor samples?

  • Quantitative thresholds:

    MetricArtifact RangeBiological Range
    H-score<5050-300
    Nuclear:Cyto Ratio<0.30.3-2.1
  • Spatial analysis: Use HALO® software to quantify periventricular vs. invasive front staining .

How to correlate pS334 status with LKB1 kinase activity in live-cell assays?

  • FRET-based biosensors:

    • LKB1 activity reporter (CKAR-LKB1) with CFP/YFP emission ratio

    • Calibrate using recombinant active LKB1 (0-100 mU/μL)

  • Single-cell correlation: Pair FRET data with post-fixation pS334 IF (r² >0.7 indicates predictive validity)

What orthogonal methods confirm pS334 antibody specificity in xenograft models?

  • Species-specific qPCR: Human-specific STK11 primers (5'-CAGGTGCTGGAGAAACTGGA-3') vs. mouse .

  • Multiplex IHC: Co-stain with mitochondrial markers (TOMM20) to confirm LKB1 localization .

  • Pharmacodynamic analysis: Monitor pS334 levels 24 hr post-METformin (100 mg/kg) treatment .

Quick Inquiry

Personal Email Detected
Please use an institutional or corporate email address for inquiries. Personal email accounts ( such as Gmail, Yahoo, and Outlook) are not accepted. *
© Copyright 2025 TheBiotek. All Rights Reserved.