Phospho-STK11 (S428) Antibody

Shipped with Ice Packs
In Stock

Description

Introduction to Phospho-STK11 (S428) Antibody

STK11/LKB1 is a tumor suppressor kinase that regulates cell polarity, energy metabolism, and AMP-activated protein kinase (AMPK) signaling. Phosphorylation at Ser428 is essential for its activation and downstream functions . The Phospho-STK11 (S428) antibody specifically recognizes this post-translational modification, making it indispensable for studying STK11-mediated pathways in diseases such as Peutz-Jeghers syndrome, pancreatic cancer, and metabolic disorders .

Key Applications

  • Western Blot: Detects phosphorylated STK11 in HeLa, HEK293, and other cell lines .

  • Functional Studies: Used to investigate AMPK activation, cell polarity regulation, and apoptosis .

  • Disease Research: Links STK11 phosphorylation to Peutz-Jeghers syndrome, pancreatic cancer, and metabolic dysregulation .

Notable Findings

  • AMPK Activation: Phosphorylation at Ser428 is required for STK11-mediated AMPK activation, a key regulator of cellular energy homeostasis .

  • Subcellular Localization: Phosphorylated STK11 translocates to the cytoplasm upon metformin treatment, enhancing AMPK signaling .

  • Cancer Relevance: Dysregulation of STK11 phosphorylation correlates with tumor progression and chemoresistance .

STK11/LKB1 Functional Insights

AspectDetails
Cellular LocalizationCytoplasm, nucleus, mitochondrion
Downstream TargetsAMPK, MARKs, NUAKs, SIKs
Disease AssociationPeutz-Jeghers syndrome, pancreatic/testicular cancers, metabolic syndromes

Phosphorylation Dynamics

  • Regulatory Role: Ser428 phosphorylation is modulated by kinases such as RPS6KA1 and PKA, influencing cell growth and apoptosis .

  • Cross-Talk with PKC-ζ: PKC-ζ-mediated phosphorylation at Ser399 (isoform-specific) synergizes with Ser428 modification to regulate nuclear export and AMPK activation .

Validation Metrics

  • Specificity: Confirmed via knockdown/knockout assays and peptide-blocking experiments .

  • Band Confirmation: Single band at ~49–55 kDa in HeLa and HEK293 lysates .

  • Cross-Reactivity: No cross-reactivity with non-phosphorylated STK11 or unrelated proteins .

Example Data

FigureDescription
Western BlotHEK293 cells transfected with STK11 show a 55 kDa band under metformin treatment .
ImmunofluorescenceCytoplasmic localization of phosphorylated STK11 in HUVECs and A549 cells .

Product Specs

Buffer
Liquid in PBS containing 50% glycerol, 0.5% BSA, and 0.02% sodium azide.
Form
Liquid
Lead Time
We typically dispatch products within 1-3 business days after receiving your order. Delivery times may vary depending on the purchase method and location. Please contact your local distributors for specific delivery times.
Synonyms
hLKB1 antibody; Liver kinase B1 antibody; LKB1 antibody; PJS antibody; Polarization related protein LKB1 antibody; Renal carcinoma antigen NY-REN-19 antibody; Serine/Threonine Kinase 11 antibody; Serine/threonine protein kinase 11 antibody; Serine/threonine protein kinase LKB1 antibody; Serine/threonine protein kinase STK11 antibody; Serine/threonine-protein kinase 11 antibody; Serine/threonine-protein kinase LKB1 antibody; Serine/threonine-protein kinase XEEK1 antibody; Stk11 antibody; STK11_HUMAN antibody
Target Names
Uniprot No.

Target Background

Function
Phospho-STK11 (S428) Antibody targets the phosphorylated form of STK11, also known as LKB1, a tumor suppressor serine/threonine-protein kinase. This kinase plays a crucial role in regulating the activity of AMP-activated protein kinase (AMPK) family members, thereby influencing various cellular processes, including cell metabolism, polarity, apoptosis, and DNA damage response.

Specifically, STK11 phosphorylates the T-loop of AMPK family proteins, enhancing their activity. This phosphorylation event impacts a wide range of downstream targets, including PRKAA1, PRKAA2, BRSK1, BRSK2, MARK1, MARK2, MARK3, MARK4, NUAK1, NUAK2, SIK1, SIK2, SIK3, and SNRK, but not MELK. Furthermore, STK11 can also phosphorylate non-AMPK family proteins, such as STRADA, PTEN, and potentially p53/TP53.

As a key upstream regulator of AMPK, STK11 mediates phosphorylation and activation of AMPK catalytic subunits, PRKAA1 and PRKAA2. This regulation impacts critical cellular processes: inhibition of signaling pathways promoting cell growth and proliferation under low energy conditions, maintenance of glucose homeostasis in the liver, activation of autophagy during nutrient deprivation, and B-cell differentiation in the germinal center in response to DNA damage.

Beyond its role in energy metabolism, STK11 also functions as a regulator of cellular polarity by remodeling the actin cytoskeleton. Its activity is essential for cortical neuron polarization, where it phosphorylates and activates BRSK1 and BRSK2, ultimately leading to axon initiation and specification.

STK11 participates in the DNA damage response by interacting with p53/TP53 and being recruited to the CDKN1A/WAF1 promoter, contributing to transcriptional activation. While STK11 can phosphorylate p53/TP53, the significance of this event in vivo is unclear, and phosphorylation may be indirect, mediated by the downstream STK11/LKB1 kinase NUAK1.

Additionally, STK11 serves as a mediator of p53/TP53-dependent apoptosis through its interaction with p53/TP53. During apoptosis, STK11 translocates to the mitochondrion and regulates p53/TP53-dependent apoptotic pathways. This kinase also plays a role in regulating the UV radiation-induced DNA damage response mediated by CDKN1A. In conjunction with NUAK1, STK11 phosphorylates CDKN1A in response to UV radiation, contributing to its degradation, which is necessary for optimal DNA repair.

STK11 has been implicated in spermiogenesis, suggesting its broad influence on cellular processes.
Gene References Into Functions
  1. WIPI3 and WIPI4 beta-propellers have roles as scaffolds for LKB1-AMPK-TSC signaling circuits in the control of autophagy. PMID: 28561066
  2. The function of human LKB1 depends on membrane binding. LKB1 is down-regulated in malignant melanoma. PMID: 28649994
  3. LKB1 expression was abnormally reduced in >80% of gallbladder carcinoma (GBC) tissues, and that the downregulation of LKB1 mRNA expression was associated with the poor prognosis of patients with GBC. PMID: 30015925
  4. Low LKB1 expression is associated with prostate cancer. PMID: 29566997
  5. Decreases in LKB1 expression by HBx protein-mediated p53 inactivation may play an important role in HBV-associated hepatocellular tumorigenesis. PMID: 29475611
  6. LKB1 performed as a tumor suppressor in lung cancer inhibiting proliferation of lung cancer cells and inducing their apoptosis. LKB1 also inhibited the in vivo growth of lung cancer. After treatment with cyclopamine, the activated Shh signaling pathway induced by LKB1 silencing was suppressed, and the inactivated Shh signaling pathway induced by LKB1 over-expression was enhanced. PMID: 29573522
  7. Cytoplasmic LKB1 promotes the growth of lung adenocarcinoma and could be a prognostic marker for lung adenocarcinoma. PMID: 30033530
  8. Here we report a novel frameshift mutation of STK11 in a Chinese Peutz-Jeghers syndrome family. PMID: 29301733
  9. findings demonstrate that LKB1 plays an important role in the maintenance of LSCs, which may be responsible for drug resistance and AML relapse PMID: 28397012
  10. STK11 mutation found in duodenal adenomas/adenocarcinoma highlight the importance of proteins encoded by these genes in tumor development. PMID: 29525853
  11. Study revealed a new role for LKB1 in promoting cell motility by downregulating migration-suppressing miRNA expression and exosome secretion. PMID: 29138862
  12. In our cohort enriched for advanced NSCLC patients who received platinum-based chemotherapy, STK11 mutations were not specifically associated with clinico-pathological features and they did not impact upon survival. PMID: 29191602
  13. Study found that ablation of Lkb1 in adipocytes induced inflammation and macrophage invasion in sciatic nerves, leading to severe sciatic axon abnormality and hindlimb paralysis. PMID: 29032027
  14. Data indicate that LKB1 is a potential suppressor of metastasis of pancreatic ductal carcinoma (PDC). Furthermore, results demonstrate that LKB1 promotes Snail protein degradation though enhancing interaction between E3 ligase FBXL14 and Snail to increase Snail ubiquitination. PMID: 29601127
  15. Ex vivo models showed that MDA-MB-231, a mesenchymal tumor cell line, grew in suspension only if LKB1 was upregulated, but the MCF-7 epithelial cell line lost its ability to generate spheroids and colonies when LKB1 was inhibited, supporting the idea that LKB1 might be necessary for circulating tumor cells to overcome the absence of the extracellular matrix during the early phases of intravasation. PMID: 28700115
  16. we speculate that YAP/TAZ in dependent of FOS may promote DNMT1 and subsequently mediate DNMT1-G9A complex involving serine metabolism and the methylation of DNA and histone. We hope that our study will stimulate further studies and a new targeted therapy and early medical intervention for YAP/TAZ could be a useful option for breast cancer cases complicated with LKB1 deficiency. PMID: 28931725
  17. Results show that STK11 mutation is a biomarker for responsiveness to cardiac glycosides (CGs). PMID: 27431571
  18. Data suggest that the hereditary Peutz-Jeghers syndrome (PJS) in the family may be attributed to the serine/threonine kinase 11 (STK11) gene missense mutation detected in both daughter and mother. PMID: 29419869
  19. LKB1 expression promoted an adaptive response to energy stress induced by anchorage-independent growth. Finally, this diminished adaptability sensitized LKB1-deficient cells to combinatorial inhibition of mitochondrial complex I and glutaminase. PMID: 28034771
  20. these data uncover that ADIPOQ/adiponectin induces autophagic cell death in breast cancer and provide in vitro and in vivo evidence for the integral role of STK11/LKB1-AMPK-ULK1 axis in ADIPOQ/adiponectin-mediated cytotoxic autophagy. PMID: 28696138
  21. Our data hint at a possible predictive impact of LKB1 expression in patients with aNSCLC treated with chemotherapy plus bevacizumab. PMID: 28119362
  22. Our results indicate that LKB1 Phe354Leu polymorphism may play an important role in leukemogenesis and represents a poor prognostic factor. PMID: 28882949
  23. we have demonstrated a novel function of LKB1 in DNA damage response. Cancer cells lacking LKB1 are more susceptible to DNA damage-based therapy and, in particular, to drugs that further impair DNA repair, such as PARP inhibitors. PMID: 27705915
  24. LKB1 overexpression inhibited apoptosis and activated autophagy of Eca109 cells following radiation treatment, as determined by flow cytometry and western blot analyses. PMID: 28656285
  25. In this study, compound heterozygous variants of LKB1, c.890G > A/ c.1062C > G and del(exon1)/ c.1062C > G, were identified in two sporadic Chinese Peutz-Jeghers syndrome cases PMID: 28185117
  26. By downregulating acetylated LKB1 protein via HERC2, SIRT1 fine-tunes the crosstalk between endothelial and vascular smooth muscle cells to prevent adverse arterial remodeling and maintain vascular homeostasis PMID: 27259994
  27. Data indicate that nesfatin-1/NUCB-2 enhanced migration, invasion and epithelial-mesenchymal transition (EMT) in colon cancer cells through LKB1/AMPK/TORC1/ZEB1 pathways in vitro and in vivo. PMID: 27150059
  28. STK11 sequence deletions and point mutations were found in 11 Chinese children with Peutz-Jeghers syndrome. PMID: 27467201
  29. define a CIII-PI3K-regulated endosomal signalling platform from which LKB1 directs epithelial polarity, the dysregulation of which endows LKB1 with tumour-promoting properties PMID: 29084199
  30. Structure of the complex of phosphorylated liver kinase B1 and 14-3-3zeta has been reported. PMID: 28368277
  31. a novel de-novo germline mutation is associated with Peutz-Jeghers syndrome and elevated cancer risk PMID: 29141581
  32. STK11 mutation is associated with Lung Adenocarcinoma. PMID: 26917230
  33. Case Report: novel heterozygous mutation (c.426-448delCGTGCCGGAGAAGCGTTTCCCAG,p.S142SfsX13) in the STK11 gene causing PJS in a Chinese female without a Peutz-Jeghers syndrome family history. PMID: 28986664
  34. Low LKB1 expression is associated with non-small cell lung cancer. PMID: 28652249
  35. Macrophage LKB1 reduction caused by oxidized low-density lipoprotein promotes foam cell formation and the progression of atherosclerosis. PMID: 28827412
  36. CPS1 maintains pyrimidine pools and DNA synthesis in KRAS/LKB1-mutant lung cancer cells PMID: 28538732
  37. All together our results show that STK11ex1-2 mutations delineate an aggressive subtype of lung cancer for which a targeted treatment through STK11 inhibition might offer new opportunities. PMID: 26625312
  38. Low LKB1 expression is associated with HPV-associated cervical cancer progression. PMID: 27546620
  39. Mutations in TP53 and STK11 also impacted tumor biology regardless of KRAS status, with TP53 strongly associated with enhanced proliferation and STK11 with suppression of immune surveillance. These findings illustrate the remarkably distinct ways through which tumor suppressor mutations may contribute to heterogeneity in KRAS-mutant tumor biology. PMID: 26477306
  40. Studies indicate that the serine-threonine kinase 11 (Peutz-Jeghers syndrome) LKB1 gene is somatically mutated in female reproductive tract cancers. PMID: 27910069
  41. Our results indicate that HPV16 E6/E7 indirectly upregulated the expression of VEGF by inhibition of liver kinase B1 expression and upregulation of hypoxia-inducible factor 2alpha expression,thus propose a human papillomavirus-liver kinase B1-hypoxia-inducible factor 2A-vascular endothelial growth factor axis for the tumorigenesis of lung cancer PMID: 28720067
  42. The expression of LKB1 is down-regulated in most of the lung cell lines. PMID: 28031112
  43. Genetic variability at STK11 locus is associated with coronary artery disease risk in type 2 diabetes in the Chinese population. PMID: 28349069
  44. pregulation of PTEN and LKB1 in concert with negative or low levels of activated Akt, mTOR and S6 indicates that PI3K/Akt/mTOR pathway may not play a significant role in pathogenesis of leiomyoma. PMID: 27748285
  45. Data provide evidence for three novel mutations and three recurrent mutations in STK11 were identified in Chinese families with Peutz-Jeghers syndrome, which further broaden the mutation spectrum of STK11. PMID: 27821076
  46. The mutation detection rate for the LKB1 gene was 85.7% in our Chinese familial Peutz-Jeghers Syndrome and 63.2% in all Chinese Peutz-Jeghers Syndrome patients. The amplification and sequencing results of the flanking sequences presented 3 kinds of polymorphisms in introns of LKB1 gene: (c.374+24G>T, c.464+47_48inGGGGGCC, and c.920+7G>C). PMID: 27721366
  47. STK11 mutation in gastric in gastric-type endocervical adenocarcinoma is associated with worse prognosis. PMID: 27241107
  48. identification of a network linking metabolic and epigenetic alterations that is central to oncogenic transformation downstream of the liver kinase B1 (LKB1, also known as STK11) tumour suppressor, an integrator of nutrient availability, metabolism and growth PMID: 27799657
  49. Severely compromised endogenous LKB1 expression in the L02 cell line may confer to L02 cells tumor-initiating capacities. PMID: 27349837
  50. AMPK exerts multiple actions on TGF-beta signaling and supports that AMPK can serve as a therapeutic drug target for breast cancer PMID: 26718214

Show More

Hide All

Database Links

HGNC: 11389

OMIM: 175200

KEGG: hsa:6794

STRING: 9606.ENSP00000324856

UniGene: Hs.515005

Involvement In Disease
Peutz-Jeghers syndrome (PJS); Testicular germ cell tumor (TGCT)
Protein Families
Protein kinase superfamily, CAMK Ser/Thr protein kinase family, LKB1 subfamily
Subcellular Location
Nucleus. Cytoplasm. Membrane. Mitochondrion.; [Isoform 2]: Nucleus. Cytoplasm. Note=Predominantly nuclear, but translocates to the cytoplasm in response to metformin or peroxynitrite treatment.
Tissue Specificity
Ubiquitously expressed. Strongest expression in testis and fetal liver.

Q&A

What is STK11 and why is phosphorylation at S428 significant?

STK11, also known as LKB1, is a tumor suppressor serine/threonine protein kinase that controls the activity of AMP-activated protein kinase (AMPK) family members. It plays critical roles in cell metabolism, polarity, apoptosis, and DNA damage response . Phosphorylation at serine 428 is particularly significant because:

  • It is required to inhibit cell growth

  • It is essential during neuronal polarization to mediate phosphorylation of BRSK1 and BRSK2

  • It is catalyzed by RPS6KA1 and/or protein kinase A (PKA)

  • Unlike phosphorylation at other sites (e.g., T363), S428 phosphorylation remains relatively constant regardless of ionizing radiation exposure, suggesting distinct regulatory mechanisms

Understanding this specific phosphorylation event provides insights into STK11's function as a tumor suppressor and its role in various cellular processes.

What are the typical applications for Phospho-STK11 (S428) antibodies?

Phospho-STK11 (S428) antibodies are valuable research tools with several validated applications:

ApplicationTypical Dilution RangeCommon Sample Types
Western Blot (WB)1:500-1:2000Cell lysates, tissue extracts
ELISA1:40000 (starting at 1 μg/mL)Various protein samples
Immunohistochemistry (IHC-P)1:100-1:300FFPE tissue sections
Immunofluorescence (IF)Application-specificFixed cells, tissue sections

These applications allow researchers to detect and analyze phosphorylated STK11 in various cell types, facilitating studies in cell signaling, metabolism, and cancer biology .

How does STK11 phosphorylation relate to tumor suppression?

STK11 functions as a tumor suppressor through several mechanisms where phosphorylation plays a regulatory role:

  • Phosphorylation at S428 is required for STK11's growth inhibitory function

  • STK11 acts as a key upstream regulator of AMPK by phosphorylating and activating AMPK catalytic subunits (PRKAA1 and PRKAA2)

  • This activation leads to inhibition of signaling pathways that promote cell growth and proliferation, especially when energy levels are low

  • STK11 mutations that inactivate its endogenous activity can negatively regulate mTORC1 signaling, resulting in phosphorylation and activation of downstream targets like S6K1 and S6

  • This dysregulation promotes protein synthesis, cell growth, and tumorigenesis

  • Novel STK11 missense mutations can induce phosphorylation of S6, promoting abnormal cell proliferation

Methodologically, researchers can use Phospho-STK11 (S428) antibodies alongside phospho-specific antibodies for downstream targets (like p-S6K1 and p-S6) to monitor this pathway in experimental systems.

How can researchers distinguish between different STK11 phosphorylation sites and their distinct functions?

Distinguishing between different STK11 phosphorylation sites requires careful methodological approach:

  • Site-specific antibodies: Use antibodies that specifically recognize distinct phosphorylation sites:

    • Anti-Phospho-STK11 (S428) for serine 428 phosphorylation

    • Anti-Phospho-STK11 (T363) for threonine 363 phosphorylation

  • Differential regulation analysis: Compare phosphorylation patterns under various conditions:

    • S428 phosphorylation remains relatively constant regardless of ionizing radiation treatment

    • T363 phosphorylation is ATM-dependent and increases significantly after ionizing radiation

  • Mutational analysis: Generate point mutations at specific phosphorylation sites and assess:

    • Effects on downstream signaling (e.g., AMPK activation)

    • Changes in subcellular localization

    • Alterations in protein-protein interactions

  • Functional assays: Design experiments to test site-specific functions:

    • Cell growth inhibition assays for S428 phosphorylation

    • Neuronal polarization assays for S428's role in BRSK1/2 phosphorylation

    • DNA damage response assays for T363 phosphorylation

  • Mass spectrometry: For comprehensive phosphorylation status analysis and quantification of multiple sites simultaneously

This multi-faceted approach allows researchers to establish causal relationships between specific phosphorylation events and distinct STK11 functions.

What are the best experimental controls when studying STK11 S428 phosphorylation in cancer models?

Robust experimental controls are essential when studying STK11 S428 phosphorylation in cancer models:

Positive controls:

  • HeLa cells transfected with wild-type STK11

  • HEK293 cells transfected with human STK11 treated with metformin

  • Known STK11 wild-type cancer cell lines

Negative controls:

  • A549 cells (lack functional STK11)

  • STK11 knockout cell lines generated via CRISPR-Cas9

  • Samples treated with lambda phosphatase to remove phosphorylation

  • Non-transfected cells in overexpression experiments

Mutation controls:

  • Cells expressing kinase-dead STK11 mutants

  • Cells with phospho-null mutants (S428A)

  • Cells with phospho-mimetic mutants (S428D or S428E)

Treatment controls:

  • mTOR inhibitors (e.g., rapamycin) to test downstream pathway effects

  • AMPK activators (e.g., metformin) to examine pathway activation

  • ATM inhibitors when studying ionizing radiation effects

Antibody validation controls:

  • Blocking peptide competition assays

  • Immunoprecipitation followed by mass spectrometry

  • Comparison with alternative antibody clones

These controls help establish specificity, validate phosphorylation status, and confirm functional consequences of STK11 S428 phosphorylation in cancer models.

How do STK11 mutations affect S428 phosphorylation status, and what are the implications for cancer therapy resistance?

STK11 mutations can significantly impact S428 phosphorylation with important implications for therapy:

Mutation effects on phosphorylation:

  • Missense mutations can disrupt the protein kinase activity of STK11

  • Novel STK11 missense mutations (e.g., c.869T>C and c.88G>A) can lead to increased phosphorylation of downstream targets like S6K1 and S6, indicating dysregulation of the STK11-mTORC1 axis

  • STK11 mutations that inactivate its endogenous activity can negatively regulate mTORC1 signaling

Therapeutic implications:

Methodological approach for researchers:

  • Characterize STK11 mutation status in patient samples or cell models

  • Assess S428 phosphorylation status using validated antibodies

  • Evaluate downstream pathway activation (mTOR/S6K1/S6 phosphorylation)

  • Correlate findings with response to immunotherapy and other cancer treatments

  • Consider combination therapies targeting both STK11-related pathways and immune checkpoints

These findings highlight the importance of comprehensive STK11 mutation and phosphorylation status assessment when designing personalized cancer treatment strategies.

What are the key protocol optimization steps for detecting STK11 S428 phosphorylation by Western blot?

Optimizing Western blot protocols for Phospho-STK11 (S428) detection requires attention to several critical factors:

Sample preparation:

  • Use phosphatase inhibitors (e.g., sodium fluoride, sodium orthovanadate) in lysis buffers to preserve phosphorylation status

  • Process samples rapidly and maintain cold temperatures throughout

  • For subcellular localization studies, perform proper fractionation to separate nuclear, cytoplasmic, and membrane compartments where STK11 may reside

Antibody selection and validation:

  • Choose antibodies with validated specificity for the phospho-S428 epitope

  • Confirm antibody performance with positive controls (e.g., cells treated with agents known to induce S428 phosphorylation)

  • Consider using total STK11 antibodies in parallel to normalize phosphorylation signals

Protocol optimization:

  • Dilution range: Start with 1:500-1:2000 as recommended for most Phospho-STK11 (S428) antibodies

  • Blocking: 5% BSA in TBST is generally more effective than milk for phospho-epitope detection

  • Incubation conditions: Overnight at 4°C often yields better results than shorter incubations

  • Detection system: Enhanced chemiluminescence with high-sensitivity substrates for low abundance phosphoproteins

Validation approaches:

  • Lambda phosphatase treatment of control samples to demonstrate phospho-specificity

  • Using cell lines with known STK11 status (wild-type vs. mutant)

  • Comparing with other detection methods (e.g., ELISA or immunoprecipitation followed by mass spectrometry)

Data analysis considerations:

  • Normalize phospho-STK11 (S428) signal to total STK11 to account for expression level differences

  • Include loading controls (e.g., GAPDH, β-actin) for total protein normalization

  • Consider quantitative analysis using appropriate software for densitometry

Following these optimization steps will enhance the specificity, sensitivity, and reproducibility of Phospho-STK11 (S428) detection by Western blot.

How can researchers accurately assess the functional significance of STK11 S428 phosphorylation in cell-based models?

Assessing the functional significance of STK11 S428 phosphorylation requires a multi-faceted approach:

Genetic manipulation strategies:

  • Site-directed mutagenesis:

    • Generate S428A (phospho-null) mutants to prevent phosphorylation

    • Create S428D or S428E (phospho-mimetic) mutants to simulate constitutive phosphorylation

    • Use these constructs in rescue experiments with STK11-deficient cell lines

  • Expression systems:

    • Use inducible expression systems to control timing and level of STK11 variant expression

    • Ensure physiologically relevant expression levels to avoid artifacts from overexpression

Functional assays:

  • Cell proliferation and growth:

    • Cell Counting Kit-8 (CCK-8) assays to measure proliferation rates

    • Colony formation assays to assess long-term growth potential

    • Cell cycle analysis using flow cytometry

  • Apoptosis and cell death:

    • Annexin V-APC and 7-AAD staining followed by flow cytometry

    • Caspase activity assays

    • TUNEL assays for DNA fragmentation

  • Cellular energy metabolism:

    • Measure AMPK activation (phospho-AMPK T172) as a direct downstream target

    • Assess mTOR pathway activation via phospho-S6K1 (T389) and phospho-S6 (Ser240/244)

    • Monitor glucose uptake and ATP production

  • Cell polarity and migration:

    • Wound healing assays

    • Transwell migration/invasion assays

    • Immunofluorescence for polarity markers

Pharmacological approaches:

  • Use kinase inhibitors to target RPS6KA1 or PKA (kinases that phosphorylate S428)

  • Apply mTOR inhibitors to assess pathway dependency

  • Employ metformin to activate AMPK and evaluate downstream effects

Correlation with clinical samples:

  • Compare findings from cell models with immunohistochemistry results from patient tissues

  • Analyze gene expression profiles associated with different STK11 phosphorylation states

This comprehensive approach allows researchers to establish causal relationships between STK11 S428 phosphorylation and specific cellular phenotypes.

What are the recommended protocols for using Phospho-STK11 (S428) antibodies in immunohistochemistry studies of cancer tissues?

Immunohistochemistry (IHC) with Phospho-STK11 (S428) antibodies requires careful optimization for reliable results in cancer tissue studies:

Tissue preparation and antigen retrieval:

  • Fixation: Use 10% neutral buffered formalin with controlled fixation time (12-24 hours)

  • Sectioning: 3-5 μm sections on positively charged slides

  • Antigen retrieval methods:

    • Heat-induced epitope retrieval using citrate buffer (pH 6.0) or EDTA buffer (pH 9.0)

    • Optimize retrieval time (typically 15-20 minutes)

    • Allow cooling to room temperature gradually

Antibody protocol optimization:

  • Blocking:

    • 3% hydrogen peroxide (10 minutes) to block endogenous peroxidase

    • 5% normal serum (1 hour) to reduce non-specific binding

  • Primary antibody incubation:

    • Dilution range: Start with 1:100-1:300 as recommended

    • Incubation time: Overnight at 4°C generally yields better results

    • Consider using antibody diluent with background-reducing components

  • Detection system:

    • Polymer-based detection systems often provide better signal-to-noise ratios

    • DAB chromogen for visualization

    • Hematoxylin counterstain optimized to allow clear visualization of nuclear and cytoplasmic staining

Controls and validation:

  • Positive control tissues:

    • Colon hamartomatous polyp tissues from patients with known STK11 mutations

    • Breast intraductal papillary tumors with STK11 mutations

  • Negative controls:

    • Omitting primary antibody

    • Normal tissues from non-mutation carriers

    • Tissues treated with lambda phosphatase

  • Comparative analysis:

    • Parallel staining with total STK11 antibodies

    • Correlation with downstream markers (e.g., phospho-S6)

Scoring and interpretation:

  • Establish clear scoring criteria:

    • Consider both staining intensity and percentage of positive cells

    • Document subcellular localization (nuclear vs. cytoplasmic)

  • Blinded assessment:

    • Have multiple pathologists score independently

    • Use digital image analysis for objective quantification when possible

  • Correlation with molecular data:

    • STK11 mutation status

    • Expression of downstream targets

    • Clinical outcomes

Following these protocols will enhance the reproducibility and interpretability of Phospho-STK11 (S428) IHC results in cancer tissue studies.

What are the most common technical issues when working with Phospho-STK11 (S428) antibodies and how can they be resolved?

Researchers frequently encounter several technical challenges when working with Phospho-STK11 (S428) antibodies:

Issue 1: Weak or absent signal
Potential causes and solutions:

  • Low phosphorylation levels: Stimulate cells with agents known to induce S428 phosphorylation

  • Phosphatase activity: Ensure complete phosphatase inhibition during sample preparation

  • Insufficient antigen retrieval: Optimize antigen retrieval methods for IHC or improve cell lysis for Western blot

  • Antibody concentration: Increase primary antibody concentration within recommended range (1:500-1:2000 for WB, 1:100-1:300 for IHC)

  • Incubation time: Extend primary antibody incubation (overnight at 4°C)

  • Detection sensitivity: Use high-sensitivity detection systems (e.g., SuperSignal West Femto for WB)

Issue 2: High background or non-specific binding
Potential causes and solutions:

  • Blocking inefficiency: Use 5% BSA instead of milk for phospho-epitopes

  • Antibody specificity: Validate antibody with appropriate controls (e.g., phosphatase treatment)

  • Wash conditions: Increase wash duration and number of washes

  • Antibody dilution: Optimize dilution with titration experiments

  • Cross-reactivity: Check for sequence homology with other phospho-proteins

Issue 3: Inconsistent results between experiments
Potential causes and solutions:

  • Phosphorylation dynamics: Standardize cell treatment conditions and harvest timing

  • Sample handling: Minimize time between cell lysis and protein denaturation

  • Freeze-thaw cycles: Avoid repeated freeze-thaw cycles of antibody and samples

  • Storage conditions: Store antibody according to manufacturer recommendations (-20°C, avoid freeze-thaw cycles)

  • Lot-to-lot variability: Test new antibody lots against previously validated lots

Issue 4: Discrepancy between phospho-signal and known biology
Potential causes and solutions:

  • Antibody cross-reactivity: Confirm results with alternative detection methods

  • Cell line authentication: Verify cell line identity and STK11 status

  • Pathway compensation: Consider parallel activation of compensatory pathways

  • Technical artifacts: Include appropriate positive and negative controls

  • Context-dependent regulation: Consider cell type-specific or microenvironment factors

Issue 5: Different results across detection methods
Potential causes and solutions:

  • Method-specific artifacts: Compare results from multiple techniques (WB, IHC, ELISA)

  • Epitope accessibility: Different sample preparation methods may affect epitope exposure

  • Antibody performance variation: Some antibodies perform better in certain applications

  • Quantification limitations: Consider the dynamic range and linearity of each method

  • Sample processing effects: Standardize sample processing across methods

Addressing these common issues through systematic troubleshooting will improve the reliability and interpretability of results obtained with Phospho-STK11 (S428) antibodies.

How do researchers reconcile contradictory findings about STK11 S428 phosphorylation in different cancer contexts?

Reconciling contradictory findings about STK11 S428 phosphorylation requires careful methodological approaches and critical analysis:

Sources of contradictions and methodological solutions:

  • Tissue and cancer type heterogeneity:

    • Systematically compare STK11 phosphorylation across different tissue types and cancer subtypes

    • Account for tissue-specific cofactors and regulators (e.g., STRAD, MO25)

    • Design studies that directly compare multiple cancer types using identical methodologies

  • Technical and antibody variability:

    • Validate results with multiple antibody clones from different manufacturers

    • Employ orthogonal techniques (mass spectrometry) to confirm phosphorylation status

    • Standardize protocols across research groups for better comparability

  • Upstream kinase differences:

    • Investigate the expression and activity of kinases responsible for S428 phosphorylation (RPS6KA1, PKA) in different contexts

    • Consider the activation status of these kinases under various experimental conditions

  • Genetic background effects:

    • Characterize the full spectrum of STK11 mutations and their effects on S428 phosphorylation

    • Consider interactions with other genetic alterations (e.g., KRAS, KEAP1)

    • Use isogenic cell lines with controlled genetic backgrounds for direct comparisons

  • Signaling context differences:

    • Map the complete signaling network around STK11 in each experimental system

    • Consider activation status of parallel pathways that might compensate for STK11 dysfunction

    • Analyze temporal dynamics of phosphorylation events under various stimuli

Data interpretation framework:

  • Establish a standardized reporting system:

    • Document all experimental variables in publications (cell lines, passage number, antibody catalog numbers, etc.)

    • Report quantitative rather than qualitative assessments of phosphorylation

    • Include comprehensive controls for each experiment

  • Meta-analysis approach:

    • Systematically compare findings across multiple studies and cancer types

    • Weight evidence based on methodological rigor and reproducibility

    • Identify patterns that might explain apparent contradictions

  • Integrative multi-omics:

    • Combine phospho-proteomics with genomics, transcriptomics, and functional data

    • Correlate S428 phosphorylation with pathway activation markers

    • Build computational models that can account for context-dependent effects

  • Clinical correlation:

    • Compare findings from cell lines with patient-derived materials

    • Correlate S428 phosphorylation patterns with clinical outcomes

    • Consider treatment history and its impact on signaling networks

By applying these methodological approaches, researchers can better understand the context-dependent nature of STK11 S428 phosphorylation and reconcile apparently contradictory findings in different cancer settings.

What are the important considerations when interpreting STK11 S428 phosphorylation data in the context of cancer immunotherapy resistance?

Interpreting STK11 S428 phosphorylation data in the context of immunotherapy resistance requires careful consideration of several factors:

Biological context considerations:

Methodological recommendations:

  • Comprehensive biomarker analysis:

    • Combine STK11 phosphorylation assessment with:

      • STK11 mutation analysis

      • PD-L1 expression evaluation

      • Tumor mutational burden (TMB) assessment

      • Immune cell infiltration profiling

  • Temporal considerations:

    • Evaluate changes in phosphorylation status before, during, and after immunotherapy

    • Consider dynamic changes in response to treatment rather than single timepoint measurements

  • Multi-parameter analysis:

    • Use multiplexed immunofluorescence or mass cytometry to simultaneously assess:

      • STK11 phosphorylation status

      • Immune cell phenotypes and activation states

      • Spatial relationships between tumor and immune cells

  • Functional validation:

    • Use ex vivo tumor models to test how modulating STK11 phosphorylation affects response to immunotherapy

    • Consider patient-derived organoids or humanized mouse models for more relevant testing systems

Interpretive framework:

By incorporating these considerations into study design and data interpretation, researchers can better understand the complex relationship between STK11 S428 phosphorylation and immunotherapy resistance, potentially identifying new therapeutic strategies for patients with STK11 alterations.

What emerging technologies and approaches might improve our understanding of STK11 S428 phosphorylation in cancer biology?

Several cutting-edge technologies and approaches are poised to advance our understanding of STK11 S428 phosphorylation:

Advanced imaging technologies:

  • Super-resolution microscopy: Visualize STK11 phosphorylation with nanometer precision in specific subcellular compartments

  • Live-cell phospho-sensors: Develop FRET-based sensors to monitor S428 phosphorylation dynamics in real-time

  • Spatial proteomics: Combine imaging mass cytometry with phospho-specific antibodies to map STK11 phosphorylation in the context of the tumor microenvironment

Single-cell technologies:

  • Single-cell phospho-proteomics: Analyze STK11 phosphorylation heterogeneity at the single-cell level

  • Multi-parameter CyTOF: Simultaneously measure multiple phospho-proteins in the STK11 pathway in individual cells

  • Single-cell spatial transcriptomics: Correlate STK11 pathway activation with gene expression patterns in spatial context

Genetic engineering approaches:

  • Base editing and prime editing: Create precise STK11 mutations or phospho-site modifications with minimal off-target effects

  • Optogenetic control: Develop light-controlled STK11 kinase activators/inhibitors to study temporal dynamics

  • Endogenous tagging: Use CRISPR knock-in strategies to tag endogenous STK11 for more physiologically relevant studies

Computational and systems biology:

  • Deep learning phosphorylation prediction: Develop algorithms to predict the functional impact of STK11 variants on S428 phosphorylation

  • Network modeling: Create comprehensive models of the STK11 signaling network across different cancer contexts

  • Multi-omics integration: Combine phospho-proteomics with genomics, transcriptomics, and metabolomics data to build holistic models of STK11 function

Translational approaches:

  • Liquid biopsy phospho-proteomics: Develop methods to detect STK11 phosphorylation in circulating tumor cells or extracellular vesicles

  • Patient-derived models: Use organoids and xenografts to study STK11 phosphorylation in more clinically relevant systems

  • Phospho-selective therapeutic targeting: Design drugs that specifically target cells with altered STK11 phosphorylation patterns

Methodological innovations:

  • Nanobody-based detection: Develop phospho-specific nanobodies for improved specificity and tissue penetration

  • Targeted mass spectrometry: Employ parallel reaction monitoring for absolute quantification of STK11 phosphorylation stoichiometry

  • Proximity labeling proteomics: Identify context-specific interactors of phosphorylated vs. non-phosphorylated STK11

These emerging technologies will provide unprecedented insights into the dynamics, heterogeneity, and functional consequences of STK11 S428 phosphorylation in cancer, potentially leading to novel therapeutic strategies.

How might researchers develop more selective tools to study STK11 S428 phosphorylation in complex biological systems?

Developing more selective tools for studying STK11 S428 phosphorylation requires innovative approaches:

Next-generation antibody technologies:

  • Recombinant antibody engineering:

    • Generate highly specific recombinant antibodies using phage display technology

    • Engineer antibody fragments (Fabs, scFvs) with enhanced specificity for the phospho-S428 epitope

    • Create bispecific antibodies that recognize both STK11 and the phospho-S428 site for improved selectivity

  • Alternative binding proteins:

    • Develop phospho-specific nanobodies with improved tissue penetration and reduced size

    • Create synthetic aptamers that specifically recognize phosphorylated S428

    • Design DARPins or affimers as alternative binding scaffolds with high affinity and specificity

Genetic tools and biosensors:

  • CRISPR-based approaches:

    • Generate knock-in cell lines with engineered STK11 variants to control phosphorylation

    • Develop split fluorescent protein systems that report on S428 phosphorylation status

    • Create degron systems that are conditionally activated by S428 phosphorylation

  • Phosphorylation biosensors:

    • Design FRET-based biosensors specific for STK11 S428 phosphorylation

    • Develop bioluminescence resonance energy transfer (BRET) sensors for live-cell imaging

    • Create sensors that change subcellular localization upon S428 phosphorylation

Chemical biology approaches:

  • Proximity-based labeling:

    • Employ BioID or APEX2 fusions to map the interactome of phosphorylated STK11

    • Develop phospho-specific proximity labeling reagents

  • Chemical genetics:

    • Engineer analog-sensitive STK11 kinases to study upstream regulation of S428

    • Develop selective inhibitors of kinases that phosphorylate S428

    • Create covalent probes that specifically recognize the phospho-S428 configuration

Analytical techniques:

  • Advanced mass spectrometry:

    • Develop targeted parallel reaction monitoring (PRM) assays for absolute quantification

    • Implement phospho-proteoform-specific assays to distinguish different phosphorylation patterns

    • Create heavy-labeled phosphopeptide standards for accurate quantification

  • Single-molecule detection:

    • Apply single-molecule pull-down (SiMPull) assays for phospho-STK11

    • Develop single-molecule FRET techniques to study conformational changes induced by phosphorylation

    • Use super-resolution microscopy with phospho-specific probes

Validation strategies:

  • Orthogonal approaches:

    • Validate findings using multiple independent technologies

    • Compare results between antibody-based and antibody-free methods

    • Develop computational pipelines to integrate data from different platforms

  • Standardization:

    • Establish reference standards for phospho-STK11 detection

    • Create shared resources of validated reagents and protocols

    • Develop unified reporting formats for phosphorylation data

Quick Inquiry

Personal Email Detected
Please use an institutional or corporate email address for inquiries. Personal email accounts ( such as Gmail, Yahoo, and Outlook) are not accepted. *
© Copyright 2025 TheBiotek. All Rights Reserved.