Phospho-STK11 (T189) Antibody

Shipped with Ice Packs
In Stock

Description

Antibody Overview

The Phospho-STK11 (T189) antibody targets the phosphorylated threonine residue at position 189 of the LKB1 protein. This phosphorylation event is critical for the activation of downstream signaling pathways, including AMP-activated protein kinase (AMPK) and related kinases. The antibody is available in polyclonal (rabbit IgG) and recombinant formats, with reactivity confirmed in human, mouse, and rat samples .

Applications

The antibody is validated for multiple techniques:

Western Blot (WB)

  • Recommended dilution: 1:1000–1:10,000 .

  • Detected in lysates of PC-3, HEK-293, and NIH/3T3 cells, with enhanced signal in calyculin A-treated samples .

Immunofluorescence (IF)/ICC

  • Dilution: 1:50–1:500 .

  • Detects phospho-LKB1 in calyculin A-treated PC-3 cells .

Flow Cytometry (FC)

  • Intra-cellular staining: 0.25 µg per 1 × 10⁶ cells .

ELISA

  • Used for quantifying phospho-LKB1 levels in lysates .

Role in Cellular Metabolism

  • LKB1 phosphorylates AMPK, a key regulator of energy homeostasis. Studies using this antibody have shown that AMPK activation by LKB1 suppresses cell growth under low-energy conditions .

  • In diabetic cardiomyopathy, chronic intermittent hypoxia exacerbates mitochondrial dysfunction via LKB1/AMPK/Nrf2 signaling, as demonstrated by WB analysis .

Cancer Biology

  • Loss of LKB1 activity is linked to aggressive HER2+ breast cancer. Mice with mammary gland-specific LKB1 deletion developed hypermetabolic tumors, which were inhibited by mTOR/2-DG treatments .

  • Mutations in LKB1 (e.g., Peutz-Jeghers syndrome) promote oncogenic pathways, including cyclin D1 activation .

Cell Polarity and Apoptosis

  • Phospho-LKB1 (T189) regulates cell polarity by activating AMPK-related kinases. Disruption of this pathway leads to tumor progression under metabolic stress .

Western Blot Protocol

  1. Lyse cells in RIPA buffer with phosphatase inhibitors.

  2. Separate 30–50 µg lysate by SDS-PAGE.

  3. Transfer to PVDF membrane and block with 5% BSA.

  4. Incubate with primary antibody (1:1000) overnight at 4°C.

  5. Detect using HRP-conjugated secondary antibodies .

Immunofluorescence Protocol

  1. Fix PC-3 cells with 4% paraformaldehyde.

  2. Permeabilize with 0.1% Triton X-100.

  3. Stain with primary antibody (1:200) and Alexa Fluor 488-conjugated secondary antibody .

Product Variants

SourceCatalog NumberReactivityApplications
Proteintech80127-1-RRHuman, MouseWB, IF, FC, ELISA
Thermo Fisher28965-1-AP100ULHuman, MouseWB, IF
Abcamab60987MouseWB
Assay GenieCABP0601Human, Mouse, RatWB

Product Specs

Buffer
Liquid in PBS containing 50% glycerol, 0.5% BSA, and 0.02% sodium azide.
Form
Liquid
Lead Time
Typically, we can ship products within 1-3 business days after receiving your order. Delivery times may vary depending on the purchasing method or location. Please consult your local distributor for specific delivery timeframes.
Synonyms
hLKB1 antibody; Liver kinase B1 antibody; LKB1 antibody; PJS antibody; Polarization related protein LKB1 antibody; Renal carcinoma antigen NY-REN-19 antibody; Serine/Threonine Kinase 11 antibody; Serine/threonine protein kinase 11 antibody; Serine/threonine protein kinase LKB1 antibody; Serine/threonine protein kinase STK11 antibody; Serine/threonine-protein kinase 11 antibody; Serine/threonine-protein kinase LKB1 antibody; Serine/threonine-protein kinase XEEK1 antibody; Stk11 antibody; STK11_HUMAN antibody
Target Names
Uniprot No.

Target Background

Function
STK11, also known as Liver Kinase B1 (LKB1), is a tumor suppressor serine/threonine-protein kinase. It plays a crucial role in regulating the activity of AMP-activated protein kinase (AMPK) family members, thereby influencing various cellular processes including metabolism, polarity, apoptosis, and DNA damage response. STK11 functions by phosphorylating the T-loop of AMPK family proteins, leading to their activation. This phosphorylation event promotes the activity of various AMPK family members, including PRKAA1, PRKAA2, BRSK1, BRSK2, MARK1, MARK2, MARK3, MARK4, NUAK1, NUAK2, SIK1, SIK2, SIK3, and SNRK, but not MELK. Additionally, STK11 phosphorylates non-AMPK family proteins such as STRADA, PTEN, and potentially p53/TP53. STK11 serves as a key upstream regulator of AMPK by mediating phosphorylation and activation of AMPK catalytic subunits PRKAA1 and PRKAA2. This regulation impacts various cellular processes, including:
  • Inhibition of signaling pathways that promote cell growth and proliferation under energy-depleted conditions.
  • Glucose homeostasis in the liver.
  • Activation of autophagy during nutrient deprivation.
  • B-cell differentiation in the germinal center in response to DNA damage.
Furthermore, STK11 acts as a regulator of cellular polarity by remodeling the actin cytoskeleton. It is essential for cortical neuron polarization by mediating phosphorylation and activation of BRSK1 and BRSK2, resulting in axon initiation and specification. STK11 is also involved in the DNA damage response. It interacts with p53/TP53 and is recruited to the CDKN1A/WAF1 promoter to participate in transcriptional activation. While STK11 can phosphorylate p53/TP53, the in vivo relevance of this observation is unclear. Phosphorylation may occur indirectly, mediated by downstream STK11/LKB1 kinase NUAK1. STK11 also acts as a mediator of p53/TP53-dependent apoptosis by interacting with p53/TP53. During apoptosis, STK11 translocates to the mitochondria and regulates p53/TP53-dependent apoptosis pathways. It regulates UV radiation-induced DNA damage response mediated by CDKN1A. In conjunction with NUAK1, STK11 phosphorylates CDKN1A in response to UV radiation, contributing to its degradation, which is essential for optimal DNA repair. STK11 also plays a role in spermiogenesis.
Gene References Into Functions
  1. WIPI3 and WIPI4 beta-propellers have roles as scaffolds for LKB1-AMPK-TSC signaling circuits in the control of autophagy. PMID: 28561066
  2. The function of human LKB1 depends on membrane binding. LKB1 is down-regulated in malignant melanoma. PMID: 28649994
  3. LKB1 expression was abnormally reduced in >80% of gallbladder carcinoma (GBC) tissues, and that the downregulation of LKB1 mRNA expression was associated with the poor prognosis of patients with GBC. PMID: 30015925
  4. Low LKB1 expression is associated with prostate cancer. PMID: 29566997
  5. Decreases in LKB1 expression by HBx protein-mediated p53 inactivation may play an important role in HBV-associated hepatocellular tumorigenesis. PMID: 29475611
  6. LKB1 performed as a tumor suppressor in lung cancer inhibiting proliferation of lung cancer cells and inducing their apoptosis. LKB1 also inhibited the in vivo growth of lung cancer. After treatment with cyclopamine, the activated Shh signaling pathway induced by LKB1 silencing was suppressed, and the inactivated Shh signaling pathway induced by LKB1 over-expression was enhanced. PMID: 29573522
  7. Cytoplasmic LKB1 promotes the growth of lung adenocarcinoma and could be a prognostic marker for lung adenocarcinoma. PMID: 30033530
  8. Here we report a novel frameshift mutation of STK11 in a Chinese Peutz-Jeghers syndrome family. PMID: 29301733
  9. findings demonstrate that LKB1 plays an important role in the maintenance of LSCs, which may be responsible for drug resistance and AML relapse PMID: 28397012
  10. STK11 mutation found in duodenal adenomas/adenocarcinoma highlight the importance of proteins encoded by these genes in tumor development. PMID: 29525853
  11. Study revealed a new role for LKB1 in promoting cell motility by downregulating migration-suppressing miRNA expression and exosome secretion. PMID: 29138862
  12. In our cohort enriched for advanced NSCLC patients who received platinum-based chemotherapy, STK11 mutations were not specifically associated with clinico-pathological features and they did not impact upon survival. PMID: 29191602
  13. Study found that ablation of Lkb1 in adipocytes induced inflammation and macrophage invasion in sciatic nerves, leading to severe sciatic axon abnormality and hindlimb paralysis. PMID: 29032027
  14. Data indicate that LKB1 is a potential suppressor of metastasis of pancreatic ductal carcinoma (PDC). Furthermore, results demonstrate that LKB1 promotes Snail protein degradation though enhancing interaction between E3 ligase FBXL14 and Snail to increase Snail ubiquitination. PMID: 29601127
  15. Ex vivo models showed that MDA-MB-231, a mesenchymal tumor cell line, grew in suspension only if LKB1 was upregulated, but the MCF-7 epithelial cell line lost its ability to generate spheroids and colonies when LKB1 was inhibited, supporting the idea that LKB1 might be necessary for circulating tumor cells to overcome the absence of the extracellular matrix during the early phases of intravasation. PMID: 28700115
  16. we speculate that YAP/TAZ in dependent of FOS may promote DNMT1 and subsequently mediate DNMT1-G9A complex involving serine metabolism and the methylation of DNA and histone. We hope that our study will stimulate further studies and a new targeted therapy and early medical intervention for YAP/TAZ could be a useful option for breast cancer cases complicated with LKB1 deficiency. PMID: 28931725
  17. Results show that STK11 mutation is a biomarker for responsiveness to cardiac glycosides (CGs). PMID: 27431571
  18. Data suggest that the hereditary Peutz-Jeghers syndrome (PJS) in the family may be attributed to the serine/threonine kinase 11 (STK11) gene missense mutation detected in both daughter and mother. PMID: 29419869
  19. LKB1 expression promoted an adaptive response to energy stress induced by anchorage-independent growth. Finally, this diminished adaptability sensitized LKB1-deficient cells to combinatorial inhibition of mitochondrial complex I and glutaminase. PMID: 28034771
  20. these data uncover that ADIPOQ/adiponectin induces autophagic cell death in breast cancer and provide in vitro and in vivo evidence for the integral role of STK11/LKB1-AMPK-ULK1 axis in ADIPOQ/adiponectin-mediated cytotoxic autophagy. PMID: 28696138
  21. Our data hint at a possible predictive impact of LKB1 expression in patients with aNSCLC treated with chemotherapy plus bevacizumab. PMID: 28119362
  22. Our results indicate that LKB1 Phe354Leu polymorphism may play an important role in leukemogenesis and represents a poor prognostic factor. PMID: 28882949
  23. we have demonstrated a novel function of LKB1 in DNA damage response. Cancer cells lacking LKB1 are more susceptible to DNA damage-based therapy and, in particular, to drugs that further impair DNA repair, such as PARP inhibitors. PMID: 27705915
  24. LKB1 overexpression inhibited apoptosis and activated autophagy of Eca109 cells following radiation treatment, as determined by flow cytometry and western blot analyses. PMID: 28656285
  25. In this study, compound heterozygous variants of LKB1, c.890G > A/ c.1062C > G and del(exon1)/ c.1062C > G, were identified in two sporadic Chinese Peutz-Jeghers syndrome cases PMID: 28185117
  26. By downregulating acetylated LKB1 protein via HERC2, SIRT1 fine-tunes the crosstalk between endothelial and vascular smooth muscle cells to prevent adverse arterial remodeling and maintain vascular homeostasis PMID: 27259994
  27. Data indicate that nesfatin-1/NUCB-2 enhanced migration, invasion and epithelial-mesenchymal transition (EMT) in colon cancer cells through LKB1/AMPK/TORC1/ZEB1 pathways in vitro and in vivo. PMID: 27150059
  28. STK11 sequence deletions and point mutations were found in 11 Chinese children with Peutz-Jeghers syndrome. PMID: 27467201
  29. define a CIII-PI3K-regulated endosomal signalling platform from which LKB1 directs epithelial polarity, the dysregulation of which endows LKB1 with tumour-promoting properties PMID: 29084199
  30. Structure of the complex of phosphorylated liver kinase B1 and 14-3-3zeta has been reported. PMID: 28368277
  31. a novel de-novo germline mutation is associated with Peutz-Jeghers syndrome and elevated cancer risk PMID: 29141581
  32. STK11 mutation is associated with Lung Adenocarcinoma. PMID: 26917230
  33. Case Report: novel heterozygous mutation (c.426-448delCGTGCCGGAGAAGCGTTTCCCAG,p.S142SfsX13) in the STK11 gene causing PJS in a Chinese female without a Peutz-Jeghers syndrome family history. PMID: 28986664
  34. Low LKB1 expression is associated with non-small cell lung cancer. PMID: 28652249
  35. Macrophage LKB1 reduction caused by oxidized low-density lipoprotein promotes foam cell formation and the progression of atherosclerosis. PMID: 28827412
  36. CPS1 maintains pyrimidine pools and DNA synthesis in KRAS/LKB1-mutant lung cancer cells PMID: 28538732
  37. All together our results show that STK11ex1-2 mutations delineate an aggressive subtype of lung cancer for which a targeted treatment through STK11 inhibition might offer new opportunities. PMID: 26625312
  38. Low LKB1 expression is associated with HPV-associated cervical cancer progression. PMID: 27546620
  39. Mutations in TP53 and STK11 also impacted tumor biology regardless of KRAS status, with TP53 strongly associated with enhanced proliferation and STK11 with suppression of immune surveillance. These findings illustrate the remarkably distinct ways through which tumor suppressor mutations may contribute to heterogeneity in KRAS-mutant tumor biology. PMID: 26477306
  40. Studies indicate that the serine-threonine kinase 11 (Peutz-Jeghers syndrome) LKB1 gene is somatically mutated in female reproductive tract cancers. PMID: 27910069
  41. Our results indicate that HPV16 E6/E7 indirectly upregulated the expression of VEGF by inhibition of liver kinase B1 expression and upregulation of hypoxia-inducible factor 2alpha expression,thus propose a human papillomavirus-liver kinase B1-hypoxia-inducible factor 2A-vascular endothelial growth factor axis for the tumorigenesis of lung cancer PMID: 28720067
  42. The expression of LKB1 is down-regulated in most of the lung cell lines. PMID: 28031112
  43. Genetic variability at STK11 locus is associated with coronary artery disease risk in type 2 diabetes in the Chinese population. PMID: 28349069
  44. pregulation of PTEN and LKB1 in concert with negative or low levels of activated Akt, mTOR and S6 indicates that PI3K/Akt/mTOR pathway may not play a significant role in pathogenesis of leiomyoma. PMID: 27748285
  45. Data provide evidence for three novel mutations and three recurrent mutations in STK11 were identified in Chinese families with Peutz-Jeghers syndrome, which further broaden the mutation spectrum of STK11. PMID: 27821076
  46. The mutation detection rate for the LKB1 gene was 85.7% in our Chinese familial Peutz-Jeghers Syndrome and 63.2% in all Chinese Peutz-Jeghers Syndrome patients. The amplification and sequencing results of the flanking sequences presented 3 kinds of polymorphisms in introns of LKB1 gene: (c.374+24G>T, c.464+47_48inGGGGGCC, and c.920+7G>C). PMID: 27721366
  47. STK11 mutation in gastric in gastric-type endocervical adenocarcinoma is associated with worse prognosis. PMID: 27241107
  48. identification of a network linking metabolic and epigenetic alterations that is central to oncogenic transformation downstream of the liver kinase B1 (LKB1, also known as STK11) tumour suppressor, an integrator of nutrient availability, metabolism and growth PMID: 27799657
  49. Severely compromised endogenous LKB1 expression in the L02 cell line may confer to L02 cells tumor-initiating capacities. PMID: 27349837
  50. AMPK exerts multiple actions on TGF-beta signaling and supports that AMPK can serve as a therapeutic drug target for breast cancer PMID: 26718214

Show More

Hide All

Database Links

HGNC: 11389

OMIM: 175200

KEGG: hsa:6794

STRING: 9606.ENSP00000324856

UniGene: Hs.515005

Involvement In Disease
Peutz-Jeghers syndrome (PJS); Testicular germ cell tumor (TGCT)
Protein Families
Protein kinase superfamily, CAMK Ser/Thr protein kinase family, LKB1 subfamily
Subcellular Location
Nucleus. Cytoplasm. Membrane. Mitochondrion.; [Isoform 2]: Nucleus. Cytoplasm. Note=Predominantly nuclear, but translocates to the cytoplasm in response to metformin or peroxynitrite treatment.
Tissue Specificity
Ubiquitously expressed. Strongest expression in testis and fetal liver.

Q&A

What is STK11/LKB1 and why is phosphorylation at T189 significant?

STK11/LKB1 is a master serine/threonine kinase that functions as a tumor suppressor and metabolic regulator. It controls the activity of AMP-activated protein kinase (AMPK) family members by phosphorylating their T-loop, thus promoting their activity . Phosphorylation at Threonine 189 (T189) is particularly significant as it represents one of the key autophosphorylation sites that regulates STK11's activation and function. When STK11 forms a complex with STRAD (STE-20-related kinase adaptor protein), it enhances STK11 autophosphorylation at several sites including T185, T336, T363, and T402, with T189 being closely related to this activation mechanism . Detection of phosphorylation at this site serves as an important indicator of STK11's active state.

STK11/LKB1 is ubiquitously expressed, with strongest expression in testis and fetal liver . Its inactivation through mutations has been associated with Peutz-Jeghers syndrome and various cancers including skin, pancreatic, and testicular cancers .

What applications is the Phospho-STK11 (T189) Antibody validated for?

The Phospho-STK11 (T189) Antibody has been validated for multiple applications across different experimental systems:

ApplicationRecommended DilutionValidated Cell Models
Western Blot (WB)1:500-1:10000PC-3, HEK-293, NIH/3T3 cells
Immunofluorescence (IF/ICC)1:50-1:500Calyculin A treated PC-3 cells
Flow Cytometry (FC) (Intra)0.25 μg per 10^6 cellsCalyculin A treated PC-3 cells
ELISA1 μg/mL starting concentrationVaries by kit

For optimal results, researchers should titrate the antibody in each specific testing system . Different suppliers recommend slightly different dilutions, so optimization for your specific experimental system is essential. Several publications have successfully used this antibody in Western blot applications .

What is the optimal sample preparation protocol for detecting phosphorylated STK11 at T189?

Proper sample preparation is critical for preserving and detecting the phosphorylated form of STK11 at T189:

  • Cell/tissue lysis: Use buffer containing phosphatase inhibitors (such as sodium fluoride, sodium orthovanadate) to prevent dephosphorylation during extraction.

  • For enhanced phosphorylation detection: Pre-treat cells with Calyculin A, a potent phosphatase inhibitor, which significantly improves the detection of phosphorylated STK11 .

  • Storage conditions: Store protein samples at -20°C in a buffer containing PBS with 0.02% sodium azide and 50% glycerol (pH 7.3) .

  • For immunoprecipitation-based approaches: Consider using anti-Flag beads if working with tagged constructs, as described in several research protocols .

  • Phosphatase controls: Include samples treated with phosphatase to confirm specificity - a genuine phospho-signal should disappear after phosphatase treatment .

The calculated molecular weight of STK11 is approximately 49 kDa, but the observed molecular weight on gels typically ranges from 50-55 kDa , which is important to note when identifying bands.

What positive and negative controls should be used when working with Phospho-STK11 (T189) Antibody?

Proper controls are essential for validating Phospho-STK11 (T189) Antibody specificity:

Positive Controls:

  • Calyculin A-treated PC-3, HEK-293, or NIH/3T3 cells

  • HeLa cells (for some antibody formulations)

  • Cells transfected with wild-type STK11 expression vectors

Negative Controls:

  • STK11 knockout or null cell lines (e.g., some A549 cell lines lack functional STK11)

  • Samples treated with lambda phosphatase

  • Cells expressing T189A mutant (alanine substitution prevents phosphorylation)

  • Kinase-dead STK11 mutants (e.g., K78I)

Validation Approaches:

  • Peptide competition assays using the synthetic phosphorylated peptide from around T189

  • Comparing signals between phospho-specific and total STK11 antibodies

  • Gel shift assays that show the presence or absence of the higher molecular weight band corresponding to phosphorylated STK11

These controls help ensure that the observed signal is specific to STK11 phosphorylated at T189 rather than non-specific binding or detection of other phosphorylated proteins.

What experimental factors can affect the detection of phosphorylated STK11 at T189?

Several experimental factors can significantly impact the detection of phosphorylated STK11:

  • Phosphatase activity: Endogenous phosphatases rapidly dephosphorylate proteins during sample preparation. Always use fresh phosphatase inhibitors and keep samples cold throughout processing .

  • Cell culture conditions: Confluence, serum starvation, and metabolic state can affect STK11 phosphorylation. Standardize these conditions across experiments .

  • Stimulation time: For treatments that induce STK11 phosphorylation, optimize the duration - overexposure may lead to secondary effects or feedback inhibition.

  • Antibody specificity: Some antibodies may cross-react with similar phosphorylation motifs on other proteins. Validate with appropriate controls .

  • Detection methods: For Western blotting, ECL sensitivity or fluorescent detection systems can significantly impact sensitivity. The KAM-900P antibody microarray method offers an alternative approach using direct labeling, chemical cleavage at cysteine residues, or biotinylation before detection .

  • Sample loading: Uneven protein loading can create misleading results. Always normalize to total protein or a stable housekeeping protein, and ideally compare with total STK11 levels.

How can researchers distinguish between STK11 autophosphorylation at T189 versus phosphorylation by upstream kinases?

Distinguishing between autophosphorylation and trans-phosphorylation requires specialized experimental approaches:

  • In vitro kinase assays: Using purified recombinant STK11 with ATP in the presence or absence of potential upstream kinases. A gel shift assay described in the literature demonstrates:

    • STK11 complexes are immunoprecipitated with anti-Flag beads

    • Kinase reactions are performed on the immunoprecipitated complexes

    • SDS-PAGE reveals either a single band (no phosphorylation) or two bands (successful phosphorylation)

    • Phosphatase treatment confirms the second band is due to phosphorylation

  • Kinase-dead mutants: Express catalytically inactive STK11 (K78I) in cells and assess T189 phosphorylation. If phosphorylation occurs despite lack of kinase activity, this suggests an upstream kinase is responsible .

  • STRAD co-expression studies: STRAD enhances LKB1 autophosphorylation at sites including T185. Comparing phosphorylation in cells with and without STRAD can help determine if T189 is primarily autophosphorylated .

  • Inhibitor panels: Systematic treatment with kinase inhibitors targeting candidate upstream kinases can identify potential kinases responsible for T189 phosphorylation.

  • Structural analysis: Research shows that SL26 (a 9 bp in-frame deletion at the C-terminus of LKB1) retains intrinsic kinase activity but cannot form complexes with STRAD and accumulates in the nucleus. This structural insight can be used to design experiments separating intrinsic from extrinsic phosphorylation events .

What methodologies can be used to study the relationship between STK11 T189 phosphorylation and AMPK activation in cancer models?

To investigate the STK11-AMPK signaling axis in cancer:

  • Coordinated phosphorylation analysis:

    • Use Phospho-STK11 (T189) alongside Phospho-AMPK (T172) antibodies

    • Analyze both under various conditions (energy stress, hypoxia, drug treatments)

    • Quantify correlation between STK11 and AMPK phosphorylation across treatments

  • Mutational approaches:

    • Create T189A (cannot be phosphorylated) and T189D/E (phosphomimetic) STK11 mutants

    • Express these in STK11-null cancer cells (like A549)

    • Measure AMPK activation and downstream effects on mTOR, S6K, autophagy markers

  • Functional metabolic assays:

    • Measure oxygen consumption, extracellular acidification rate, ATP levels

    • Compare these between cells with wild-type vs. T189 mutant STK11

    • Correlate with glucose uptake or fatty acid oxidation measurements

  • Imaging technologies:

    • Use proximity ligation assays to visualize STK11-AMPK interactions

    • Perform fluorescence resonance energy transfer (FRET) with tagged proteins

    • Correlate physical interaction with phosphorylation status

  • Cancer tissue analysis:

    • In NSCLC patient samples, STK11 mutations are associated with poor outcomes

    • Compare phospho-T189 STK11 levels with AMPK activation markers in these samples

    • Correlate with clinical parameters like hypoxia or response to therapy

Research indicates that LKB1-AMPK pathway antagonizes protein synthesis by downregulating mechanistic target of rapamycin (mTOR), as demonstrated in various experimental models from cell lines to mouse tissues . Understanding how T189 phosphorylation impacts this regulation is crucial for developing targeted therapies.

How can phosphorylated STK11 (T189) be analyzed in conjunction with other phosphorylation sites to create a comprehensive profile?

Creating a comprehensive STK11 phosphorylation profile requires integrated methodologies:

  • Multiplex Western blotting approaches:

    • Use antibodies against different phosphorylation sites (T189, S428, T363, S307)

    • Compare phosphorylation patterns across treatments or conditions

    • Calculate ratios between different phosphorylation sites

  • Mass spectrometry-based phosphoproteomics:

    • Immunoprecipitate STK11 from cells under various conditions

    • Perform tryptic digestion followed by phosphopeptide enrichment

    • Use liquid chromatography-tandem mass spectrometry to identify and quantify all phosphorylation sites

  • Correlation analysis:

    • Different phosphorylation sites have distinct functions:

      • T189: Associated with activation and autophosphorylation

      • S428: Required for growth inhibition and neuronal polarization

      • S307: A novel phosphorylation site

      • T363: Phosphorylated by ATM following ionizing radiation

    • Analyze which sites change coordinately vs. independently

  • Antibody microarray technology:

    • The KAM-900P antibody microarray provides semi-quantitative analysis of protein phosphorylation states

    • Multiple methodologies (direct labeling, chemical cleavage, biotinylation) can be used

    • This approach allows parallel analysis of multiple phosphorylation sites

  • Sequential phosphatase treatments:

    • Use phosphatases with different specificities to selectively remove phosphate groups

    • Re-probe with site-specific antibodies to determine hierarchy of phosphorylation

By profiling these sites together, researchers can develop a more comprehensive understanding of STK11 regulation in different cellular contexts.

What considerations should be made when using Phospho-STK11 (T189) Antibody in cells with STK11 mutations or STK11-knockout models?

When working with STK11 mutant or knockout models:

  • For STK11-null models:

    • Confirm complete absence of STK11 protein expression

    • Any signal from Phospho-STK11 (T189) Antibody likely represents non-specific binding

    • Include wild-type controls to determine background signal levels

  • For STK11 mutant models:

    • Different mutations may affect antibody epitope recognition

    • Mutations near T189 may directly interfere with antibody binding

    • Mutations in the kinase domain may prevent autophosphorylation

  • Analysis of patient-derived samples:

    • STK11 mutations are common in non-small cell lung cancer (15-35%)

    • Mutations often lead to loss of function rather than altered phosphorylation

    • In a luciferase assay study, STK11 variants showed variable effects on p53 transcriptional activity, which could be correlated with phosphorylation status

  • Validation approaches:

    • Use both phospho-specific and total STK11 antibodies

    • Include rescue experiments with wild-type STK11

    • Compare with downstream markers of STK11 activity

How can Phospho-STK11 (T189) Antibody be used to investigate the relationship between STK11 phosphorylation and tumor microenvironment factors like hypoxia?

The relationship between STK11 phosphorylation and tumor microenvironment factors:

  • Experimental designs for hypoxia studies:

    • Culture cells under controlled oxygen conditions (1-5% O₂)

    • Use chemical mimetics of hypoxia (CoCl₂, DFO)

    • Measure STK11 T189 phosphorylation at different time points

    • Compare with hypoxia markers (HIF-1α, GLUT1, CA9)

  • In vivo approaches:

    • Use pimonidazole staining to identify hypoxic tumor regions

    • Perform dual immunohistochemistry for hypoxia markers and phospho-STK11

    • Analyze spatial correlation between hypoxic regions and STK11 phosphorylation

  • Clinical correlations:

    • Recent research has demonstrated that STK11 inactivation shows a novel association with clinical hypoxia

    • This may explain its correlation with medical inoperability in early-stage non-small cell lung cancer

    • Research shows that receiving supplemental oxygen (odds ratio = 5.5), heavy smoking history (odds ratio = 6.1), and Black race (odds ratio = 4.3) were associated with increased frequency of STK11 mutations

  • Potential mechanisms:

    • Under hypoxic conditions, AMPK activation is crucial for cellular adaptation

    • STK11's role as an upstream regulator of AMPK suggests its phosphorylation status may change

    • Investigate whether hypoxia alters STK11 subcellular localization, which could affect its access to substrates

Understanding the relationship between STK11 phosphorylation and hypoxia could provide insights into tumor progression mechanisms and potential therapeutic targets, particularly in cancers with high rates of STK11 mutation like lung adenocarcinoma.

Quick Inquiry

Personal Email Detected
Please use an institutional or corporate email address for inquiries. Personal email accounts ( such as Gmail, Yahoo, and Outlook) are not accepted. *
© Copyright 2025 TheBiotek. All Rights Reserved.