PIRT Antibody

What is PIRT and what is its functional significance in cellular signaling?

PIRT is a membrane protein that functions as a key component of the TRPV1 complex, positively regulating TRPV1 activity. It binds various phosphoinositides, including phosphatidylinositol 4,5-bisphosphate (PIP2), but not phosphatidylinositol (PI) . The protein has a calculated molecular weight of 15.3 kDa, though it often appears at approximately 15-25 kDa on Western blots due to post-translational modifications . PIRT plays a crucial role in sensory neuron function and nociception by modulating TRP channel activity, making it an important target for pain research and neurological studies .

In which tissues and cell types is PIRT predominantly expressed?

PIRT is widely expressed in dorsal root ganglia (DRG) neurons. Studies using Pirt-EGFPf knockin mice demonstrate that PIRT is expressed in approximately 83.9% of all DRG neurons . PIRT expression has been detected in both peptidergic (CGRP+) and non-peptidergic (IB4+) neurons, which represent the two major subtypes of unmyelinated nociceptive C-fibers . Partially overlapping expression is also observed in myelinated neurons (NF200+ neurons). Beyond neuronal tissues, PIRT expression has been detected in human cell lines such as SH-SY5Y neuroblastoma cells, making them useful models for PIRT-related research .

What are the common applications for PIRT antibodies in research?

PIRT antibodies are utilized in multiple experimental techniques:

These techniques enable researchers to study PIRT expression, localization, and interactions in various experimental contexts .

How should I optimize Western blotting protocols when using PIRT antibodies?

When performing Western blot analysis with PIRT antibodies, consider these optimization steps:

• Sample preparation: For membrane proteins like PIRT, proper lysis buffers containing mild detergents are essential for efficient extraction.

• Loading control selection: When studying PIRT in neuronal tissues, use neuron-specific markers alongside traditional housekeeping proteins.

• Blocking conditions: PBS with 0.02% sodium azide and 50% glycerol (pH 7.3) is commonly used in antibody preparations .

• Antibody dilution: Start with manufacturer recommendations (typically 1:200-1:1000 for WB applications) and optimize based on signal intensity and background .

• Detection method: Consider enhanced chemiluminescence for sensitive detection of the relatively low-abundance PIRT protein.

• Expected molecular weight: Look for bands around 15-25 kDa, as the observed molecular weight may differ from the calculated 15.3 kDa due to post-translational modifications .

What controls should I implement when using PIRT antibodies for immunostaining?

Proper controls are critical for validating PIRT antibody specificity:

• Positive controls: Use tissues or cell lines known to express PIRT, such as DRG tissue sections or SH-SY5Y neuroblastoma cells .

• Negative controls:

  • Primary antibody omission

  • Use of Pirt knockout (Pirt−/−) tissues when available

  • Peptide competition assays using the immunizing peptide

• Co-staining validation: Confirm PIRT localization by co-staining with markers for subcellular compartments or known interacting partners like TRPV1.

• Cross-reactivity assessment: Verify antibody specificity using specificity tests such as those performed by some manufacturers (e.g., testing on arrays containing the target protein plus non-specific proteins) .

How do I select the most appropriate PIRT antibody for my specific application?

Selection criteria should include:

• Target species reactivity: Verify the antibody recognizes your species of interest (human, mouse, rat, etc.) .

• Application compatibility: Ensure the antibody has been validated for your specific application (WB, IHC, IF) .

• Clonality considerations:

  • Polyclonal antibodies (e.g., rabbit polyclonal) offer high sensitivity but potentially lower specificity

  • When available, monoclonal antibodies provide higher reproducibility for quantitative studies

• Conjugation options: Consider whether an unconjugated antibody or one with a conjugate (FITC, biotin) is more appropriate for your application .

• Immunogen information: Review the immunogen used (peptide vs. recombinant protein) and its sequence coverage of the PIRT protein .

How can I use PIRT antibodies to investigate its role in TRP channel regulation?

PIRT antibodies can be leveraged for mechanistic studies of TRP channel regulation through several approaches:

• Co-immunoprecipitation: Use PIRT antibodies to pull down protein complexes and identify TRPV1 and other interacting partners.

• Proximity ligation assays: Investigate protein-protein interactions between PIRT and TRP channels in situ.

• Phosphoinositide binding assays: Study how PIRT mediates interactions between phosphoinositides (especially PIP2) and TRP channels .

• Calcium imaging combined with immunocytochemistry: Correlate PIRT expression levels with calcium responses in sensory neurons.

• PIRT visualization in knockout/knockdown models: Assess changes in TRP channel localization and function when PIRT is absent.

These approaches help elucidate how PIRT serves as a regulatory component of the TRPV1 complex and influences pain signaling pathways .

What are the technical challenges in studying PIRT expression in neural tissues and how can they be overcome?

Researchers face several challenges when studying PIRT in neural tissues:

• Cell-type heterogeneity: DRG contains diverse neuronal populations with varying PIRT expression levels.

  • Solution: Use single-cell approaches or co-staining with neuronal subtype markers (CGRP, IB4, NF200) .

• Low protein abundance: PIRT may be present at low levels in some tissues.

  • Solution: Employ signal amplification methods like tyramide signal amplification for immunostaining or use sensitive detection systems for Western blotting.

• Antibody specificity concerns: Validating specificity in complex neural tissues.

  • Solution: Use tissues from Pirt knockout mice as negative controls and validate with multiple antibodies targeting different epitopes .

• RNA detection challenges: PIRT mRNA quantification requires careful primer design.

  • Solution: Use validated primers (e.g., Forward: 5′ACCACACCCAAAAGCAACTG′3; Reverse: 5′GCCCTATCATCCTGAGCACT′3) and normalize to appropriate reference genes like Hprt and Ppib .

How can computational approaches enhance PIRT antibody development and characterization?

Computational methods are increasingly valuable for PIRT antibody research:

• Antibody modeling: Homology modeling and molecular dynamics simulations can be employed to predict antibody structure and binding properties .

  • Tools like PIGS server and AbPredict algorithm generate 3D structural models of antibodies based on VH/VL sequences

  • These models undergo refinement through molecular dynamics simulations

• Epitope mapping: In silico approaches can predict antigenic determinants on PIRT protein.

  • Computational screening against the proteome can identify potential cross-reactivity

• Antibody optimization: Structure-based design can improve antibody specificity and affinity.

  • Rational humanization through computational CDR grafting

  • Prediction of antibody-antigen interactions through ensemble protein-protein docking

• Binding affinity prediction: Free energy calculations can estimate the impact of mutations on antibody-antigen binding.

  • Residue Scan FEP+ with lambda dynamics for rapid identification of high-quality variants

  • Protein Mutation FEP+ for accurate reproduction of experimentally determined relative free energies

These computational approaches complement experimental methods and accelerate the development of more specific and effective PIRT antibodies.

What experimental approaches can help resolve discrepancies in PIRT expression patterns across different studies?

When facing conflicting data about PIRT expression patterns:

• Multi-antibody validation: Use antibodies from different vendors or those recognizing distinct epitopes to confirm expression patterns.

  • Compare results from polyclonal and monoclonal antibodies when available

• Multi-method verification: Combine protein and mRNA detection methods.

  • Correlate immunostaining results with qPCR or in situ hybridization data

  • Example primer set: Forward 5′ACCACACCCAAAAGCAACTG′3; Reverse 5′GCCCTATCATCCTGAGCACT′3

• Knockout/knockdown controls: Generate or obtain Pirt-deficient samples as negative controls.

  • Pirt−/− mice have been established and characterized in previous studies

• Species differences consideration: Compare expression across species using species-specific antibodies.

  • Human vs. mouse differences in PIRT expression might explain discrepancies

• Experimental condition standardization: Control for factors that might affect PIRT expression.

  • Age, sex, and physiological state may influence expression levels

  • Female-specific effects have been observed in Pirt-deficient mice

What new insights have emerged regarding PIRT's role in pain sensation and nociceptive pathways?

Recent studies have expanded our understanding of PIRT's functional significance:

• Regulatory role in sensory neurons: PIRT has been confirmed as a key regulator of TRPV1 activity, with knockout studies demonstrating altered pain responses .

• Phosphoinositide binding: PIRT's ability to bind phosphoinositides, particularly PIP2, has emerged as a crucial mechanism for its modulatory effects on TRP channels .

• Metabolic connections: Investigations into Pirt-deficient mice have revealed subtle female-specific effects on energy homeostasis and glucose metabolism, suggesting sex-dependent functions beyond sensory neuron activity .

• Non-neuronal functions: Emerging evidence points to potential roles of PIRT beyond the nervous system, with implications for broader physiological processes.

These findings highlight PIRT's multifaceted roles and suggest it may be a promising target for pain management and related therapeutic approaches.

What methodological advances have improved the reliability of PIRT antibody-based experiments?

Technical innovations have enhanced experimental reliability:

• Specificity verification: Advanced validation methods now test antibodies against arrays containing target proteins plus hundreds of non-specific proteins to confirm selectivity .

• Diverse application protocols: Optimized protocols for multiple applications (WB, IF, IHC, ELISA) with specific dilution recommendations have been established .

• Combined computational-experimental approaches: Integration of high-throughput techniques with computational modeling allows better characterization of antibody-antigen interactions .

• Standardized knockout controls: The availability of well-characterized Pirt knockout models provides essential negative controls for antibody validation .

These methodological improvements help researchers obtain more reliable and reproducible results when studying PIRT expression and function.

How might PIRT antibodies contribute to therapeutic development for pain and sensory disorders?

PIRT antibodies may facilitate therapeutic development through several avenues:

• Target validation: Confirming PIRT's role in specific pain conditions through precise localization and functional studies.

• Biomarker development: Using PIRT expression patterns to identify patient subgroups that might benefit from TRP channel-targeting therapies.

• Screening platforms: Developing antibody-based assays to screen for compounds that modulate PIRT-TRP channel interactions.

• Mechanistic studies: Elucidating how PIRT regulates TRP channels in different pain conditions, potentially revealing new drug targets.

• Therapeutic antibody engineering: Designing antibodies that could modulate PIRT function directly as therapeutic agents.

As our understanding of PIRT biology expands, antibody-based approaches will likely play increasingly important roles in translating basic research into clinical applications.

What new technical approaches might enhance PIRT detection and functional characterization?

Emerging technologies offer promising improvements for PIRT research:

• Super-resolution microscopy: Techniques like STORM and PALM could reveal PIRT's nanoscale organization and co-localization with TRP channels.

• Proximity labeling approaches: BioID or APEX2 fused to PIRT could identify transient interaction partners in intact cells.

• CRISPR-based tagging: Endogenous tagging of PIRT for live-cell imaging and functional studies without overexpression artifacts.

• Single-cell proteomics: Analyzing PIRT expression and modification states in individual neurons to understand cell-type-specific functions.

• Cryo-EM structural studies: Resolving the structure of PIRT-TRP channel complexes to understand binding interfaces and regulatory mechanisms.

These advanced approaches will likely yield more precise insights into PIRT biology and guide the development of more specific tools for its study and therapeutic targeting.