PKLR Human

What is the PKLR gene and what is its molecular structure?

The PKLR gene is located on chromosome 1 (chr1:155.259.084–155.271.225 GRCh37/hg19) and encodes the erythroid-specific pyruvate kinase enzyme (R-type pyruvate kinase, RPK), which plays a key role in glycolysis by controlling the integrity of erythrocytes . The gene contains multiple exons, with mutations distributed throughout all exonic regions . The reference transcript used for variant reporting is typically NM_000298.5, with the A of the initiation ATG assigned as +1 .

Methodologically, researchers investigating PKLR typically analyze its structure through Sanger sequencing of the entire coding region, flanking intronic sequences, and the erythroid-specific promoter, though next-generation sequencing (NGS) approaches allow more extensive analysis including intronic and regulatory regions .

What types of mutations occur in the PKLR gene and how are they categorized?

PKLR mutations are categorized into two main types:

• Missense mutations (M): Approximately 66% of pathogenic variants are missense mutations, resulting in amino acid substitutions .

• Non-missense mutations (NM): These include nonsense mutations, frameshift mutations, splicing mutations, large deletions, in-frame indels, and promoter variants .

The Human Genome Mutation Database (HGMD) reports 290 pathogenic variants (as of March 2020), while the Pyruvate Kinase Deficiency Natural History Study (PKD NHS) identified 127 different pathogenic variants in 257 patients, comprising 84 missense and 43 non-missense variants . Methodologically, variants should be assessed following American College of Medical Genetics and Genomics (ACMG) guidelines for interpretation, with functional validation through PK enzymatic assays, western blotting, reverse transcriptase PCR analysis, or gene reporter assays for variants of unknown clinical significance .

How do PKLR mutations impact clinical phenotypes in PKD patients?

Clinical severity correlates with mutation type. Patients with two non-missense mutations (NM/NM) demonstrate more severe phenotypes than those with at least one missense mutation (M/M or M/NM) . The PKD NHS cohort analysis revealed that NM/NM patients exhibit:

• Lower hemoglobin levels post-splenectomy

• Higher numbers of lifetime transfusions

• Higher rates of iron overload

• Higher rates of splenectomy

This genotype-phenotype correlation provides important prognostic information for clinicians managing PKD patients and researchers developing therapeutic approaches.

What are the challenges in detecting deep intronic variants in PKLR?

Deep intronic variants represent a significant diagnostic challenge in PKD. Of 278 participants initially enrolled in the PKD NHS, 21 (7.6%) were ineligible due to inability to demonstrate two pathogenic variants despite comprehensive analysis . This suggests the existence of undetected intronic mutations or other genetic factors.

Methodologically, detection requires:

• Whole genome or exome sequencing

• Specialized validation techniques including:

  • Loss of heterozygosity analysis by examining allele-specific cDNA

  • Minigene construct approaches to verify splicing effects

  • In silico prediction of alternative spliceosome creation

A documented example is the deep intronic mutation c.283+109C>T in intron 2, detected by whole exome sequencing in compound heterozygosity with a missense mutation. This variant creates an alternative spliceosome, confirmed by loss of heterozygosity at the cDNA level .

What PCR protocols are most effective for analyzing PKLR gene integrations?

For analyzing PKLR gene integrations, particularly in gene editing contexts, a Nested PCR approach has proven effective. The protocol involves:

• First PCR round: Using primers KI PKLR out 1F (5'-ACTGGGTGATTCTGGGTCTG-3') and KI PKLR out 4R (5'-GGGGAACTTCCTGACTAGGG-3') to amplify the left homology arm (LHA) and recombination cassette, generating a large amplicon of 3307bp .

• Second PCR round: Using 0.5μl of the first PCR product as template with primers KI PKLR in 3F (5'-GCTGCTGGGGACTAGACATC-3') and KI PKLR in 1R (5'-CGCCAAATCTCAGGTCTCTC-3') to amplify a smaller region corresponding to the LHA (approximately 1982bp) .

This nested approach increases specificity and sensitivity when verifying precise integration events, especially important when evaluating gene editing outcomes in hematopoietic stem and progenitor cells.

What gene editing strategies have been employed for correcting PKLR mutations?

Several gene editing approaches have been developed to correct PKD, with primary focus on hematopoietic stem and progenitor cells (HSPCs):

• TALEN-mediated homologous recombination:

  • Utilizes a donor matrix with homology arms designed around the TALEN target sequence in intron 2

  • Incorporates an expression cassette with splicing acceptor, codon-optimized cDNA encoding RPK exons 3-11 with FLAG tag, and polyadenylation signal

  • Includes a selection cassette with puromycin resistance

• CRISPR-Cas9 system:

  • sgRNA targeting sequence TAGGGTCTCGTCTGTCACCT

  • Expressed under U6 promoter with spCas9 under SFFV promoter

  • Alternative approaches using ribonucleoprotein (RNP) complexes assembled from tracrRNA, crRNA, and Cas9 protein

What are the key considerations for optimizing PKLR gene editing in hematopoietic stem cells?

Optimization of PKLR gene editing in HSPCs requires addressing several key factors:

These considerations are critical for clinical translation of PKLR gene editing as a therapeutic approach for PKD patients.

What evidence suggests evolutionary selection on PKLR variants?

Several lines of evidence indicate evolutionary selection on PKLR variants:

• Frequency distribution patterns:

  • PKLR SNPs show considerably higher frequencies in African populations compared to Portuguese populations

  • This pattern differs from neutral markers, suggesting selective forces

• Linkage disequilibrium patterns:

  • Strong linkage disequilibrium between PKLR and adjacent loci in individuals without malaria infection or with non-complicated malaria

  • Suggests a conserved genomic region selected for malaria protection

• Selective sweep signals:

  • xpEHH test signals of selective sweep in regions containing expression quantitative trait loci (eQTL) for PKLR and HCN3 genes in Europeans

  • This contrasts with suggestive balancing selection indicated by intermediate allele frequencies in Africa

These findings suggest complex selective mechanisms operating on the PKLR genomic region, potentially varying over time and across populations with different malaria exposure histories.

How do PKLR polymorphisms affect susceptibility to infectious diseases?

PKLR polymorphisms demonstrate divergent effects on susceptibility to different infectious diseases:

• Malaria resistance:

  • Mutations causing PK deficiency are associated with resistance to malaria in sub-Saharan Africa

  • This represents a classic example of heterozygote advantage under pathogen selection pressure

• Increased mycobacterial susceptibility:

  • The T/G/G haplotype (rs1052176/rs4971072/rs11264359) was associated with leprosy susceptibility in Rio de Janeiro (OR = 2.46, p = 0.00001) and Salvador, Brazil (OR = 1.57, p-value not specified)

  • Similar associations were observed with tuberculosis in Mozambique

This pattern represents an evolutionary trade-off, where variants selected for malaria resistance influence susceptibility to mycobacterial diseases. The mechanism likely involves iron metabolism, as PKLR mutations affect red blood cell integrity, leading to increased iron availability within macrophages that may favor multiplication of intracellular pathogens .

What are the optimal approaches for analyzing PKLR variants in population studies?

For population-level PKLR variant analysis, a multi-tiered methodological approach is recommended:

• Initial variant identification:

  • Next-generation sequencing covering entire coding regions, flanking intronic sequences, promoter regions, and regulatory elements

  • Inclusion of both case subjects and appropriate population controls

• Large indel and structural variant detection:

  • Multiplex ligation-dependent probe amplification

  • Comparative genomic hybridization arrays

  • Digital polymerase chain reaction

• Population stratification analysis:

  • Principal Component Analysis (PCA) adapted for SNP selection, considering divergence in allelic/genotype frequencies among populations as potential indicators of natural selection

  • Analysis of extended regions (≈32kb) including 10,000bp upstream and downstream of the gene loci

• Functional assessment of variants:

  • eQTL analysis to identify variants affecting PKLR expression

  • Haplotype analysis to identify linkage patterns

  • Evolutionary selection testing using methods like xpEHH

This comprehensive approach enables robust identification of both common and rare variants with potential functional significance across diverse populations.

What cellular models are most appropriate for studying PKLR function and therapeutic interventions?

Multiple cellular models have been utilized for PKLR research, each with specific advantages:

• Patient-derived induced pluripotent stem cells (iPSCs):

  • Previously established for modeling PKD phenotype

  • Allow for gene editing validation before moving to primary cells

  • Provide a renewable source of patient-specific cells

• Primary human hematopoietic progenitors:

  • More clinically relevant than iPSCs for therapeutic development

  • Colony forming unit (CFU) assays provide functional readouts after gene editing

  • Allow assessment of hematopoietic potential preservation

• Hematopoietic stem cells (HSCs):

  • Ultimate target for therapeutic gene editing

  • Engraftment in immunodeficient NSG mice provides in vivo validation

  • Challenges include maintaining stemness during ex vivo manipulation

• Erythroid differentiation models:

  • Allow assessment of functional correction through differentiation of gene-edited HSPCs

  • Enable measurement of pyruvate kinase activity and correction of metabolic defects

Each model serves specific research questions from basic understanding of PKLR function to preclinical validation of therapeutic approaches.

What are the most promising clinical translation pathways for PKLR-targeted therapies?

Several approaches show promise for clinical translation:

• Gene editing of autologous HSPCs:

  • Eliminates risk of graft-versus-host disease associated with allogeneic HSCT

  • Optimized TALEN or CRISPR approaches show high precision in preclinical models

  • Challenges in efficiency and engraftment require further refinement

• Comprehensive genetic diagnosis:

  • Improved detection of deep intronic variants through whole genome sequencing

  • Enables precise genotype-phenotype correlation for personalized management

  • Essential for eligibility determination for gene-based therapies

• Population-specific therapeutic strategies:

  • Accounting for evolutionary trade-offs in different populations

  • Targeting specific prevalent mutations in different ethnic groups

  • Considering potential impact on susceptibility to other infectious diseases

The progression of gene editing techniques for treating genetic blood cell diseases suggests clinical application for PKD is highly likely in the near future, particularly given the successful development of similar approaches for conditions like X-SCID, β-thalassemia, and sickle cell anemia .