PLA2G7 Antibody

What is PLA2G7 and what are its primary biological functions?

PLA2G7, also known as PAF-AH/Lp-PLA2 (Platelet-Activating Factor Acetylhydrolase/Lipoprotein-associated phospholipase A2), is an enzyme that plays a crucial role in catalyzing the hydrolysis of phospholipids, resulting in the liberation of free fatty acids and lysophospholipids . The significance of PLA2G7 has been established across a spectrum of metabolic and inflammatory disorders, including atherosclerosis, diabetes, and autoimmune diseases . In recent years, PLA2G7 has gained attention as a potential biomarker with diagnostic and prognostic implications in various malignancies .

When designing experiments to study PLA2G7 function, researchers should consider its tissue-specific expression patterns and its role in both normal physiological processes and pathological conditions. Functional studies typically involve gene silencing or pharmacological inhibition approaches to elucidate the specific contributions of PLA2G7 to cellular processes such as proliferation, apoptosis, and migration.

What types of PLA2G7 antibodies are commercially available for research applications?

Several types of PLA2G7 antibodies are available for research applications, including:

• Monoclonal antibodies: These provide high specificity and are particularly useful for applications requiring consistent results across multiple experiments. For example, clone #973005 recognizes recombinant human PLA2G7/PAF-AH/Lp-PLA2 (Phe22-Asn441) .

• Polyclonal antibodies: These recognize multiple epitopes on the target protein and are useful for applications such as Western blotting. For instance, available polyclonal antibodies have been shown to detect PLA2G7 at approximately 29 kDa in human plasma under reducing conditions .

• ELISA-optimized antibody pairs: Specific antibody combinations have been developed for ELISA applications, such as the Mouse Anti-Human PLA2G7/PAF-AH/Lp-PLA2 Monoclonal Antibody, which functions as an ELISA capture antibody when paired with appropriate detection antibodies .

When selecting an antibody, researchers should consider the specific application (Western blot, immunohistochemistry, ELISA, etc.) and validate the antibody's specificity in their experimental system.

How can researchers validate the specificity of PLA2G7 antibodies in their experimental systems?

Validating antibody specificity is essential for obtaining reliable research results. For PLA2G7 antibodies, the following validation methods are recommended:

• Positive and negative controls: Include samples known to express PLA2G7 (such as human plasma) as positive controls and appropriate negative controls (tissue/cells known not to express PLA2G7).

• Western blot analysis: Verify that the antibody detects a band of the expected molecular weight (approximately 29 kDa for PLA2G7) . Consider running the blot under both reducing and non-reducing conditions, as protein conformation may affect antibody binding.

• Immunohistochemistry validation: When using PLA2G7 antibodies for tissue staining, validate results by comparing with known expression patterns and including appropriate controls. Expression can be evaluated and graded based on staining intensity (no staining, weak, moderate, or strong) .

• Gene silencing verification: In cell culture systems, knockdown of PLA2G7 expression using siRNA or CRISPR-Cas9 should result in reduced antibody signal.

• Recombinant protein competition: Pre-incubating the antibody with recombinant PLA2G7 should reduce or eliminate specific binding in a concentration-dependent manner.

How is PLA2G7 expression associated with cancer progression and prognosis?

The relationship between PLA2G7 expression and cancer outcomes varies by cancer type:

• Hepatocellular Carcinoma (HCC): Macrophage-specific PLA2G7 expression correlates with poorer prognosis and resistance to immunotherapy in HCC patients . Single-cell RNA sequencing analyses have revealed predominant PLA2G7 expression in intratumoral macrophages within the HCC microenvironment .

• Breast Cancer: High PLA2G7 expression is associated with hormone receptor negativity in breast cancer . Analyses of 957 breast cancer samples compared to 13 normal breast samples indicated that PLA2G7 mRNA is overexpressed in a subset of breast cancers, particularly those with low estrogen and progesterone receptor expression (p = 0 and p = 3.4E-10, respectively) . Kaplan-Meier analysis revealed a significant association between high PLA2G7 expression and poor survival in certain breast cancer subtypes .

• Prostate Cancer: PLA2G7 has been reported as a biomarker in 50% of primary and 70% of metastatic prostate cancers, associating with aggressive disease .

• Metastatic Disease: High PLA2G7 mRNA expression has been associated with metastatic cancer across multiple organs of origin .

When investigating PLA2G7 as a prognostic biomarker, researchers should consider multivariate analyses that account for established prognostic factors and evaluate tissue-specific expression patterns using techniques such as immunohistochemistry combined with proper scoring systems.

What role does PLA2G7 play in the tumor microenvironment, particularly in relation to immune cells?

PLA2G7 plays significant roles in modulating the tumor microenvironment, with particularly important effects on immune cell function:

• Macrophage Immunosuppression: In HCC, PLA2G7 is predominantly expressed in intratumoral macrophages and contributes to their immunosuppressive function . Macrophages with high PLA2G7 expression represent a highly immunosuppressive subset that impedes CD8 T-cell activation .

• T-cell Inhibition: PLA2G7^high macrophages exhibit diminished potential for promoting pro-inflammation and supporting T-cell immunity compared to PLA2G7^low macrophages . This suppression of T-cell activity may contribute to tumor immune evasion.

• EMT Regulation: In breast cancer, functional studies have highlighted PLA2G7's putative role in regulating epithelial-mesenchymal transition (EMT)-related signaling pathways, including vimentin and E-cadherin protein expression . This suggests that PLA2G7 may contribute to tumor progression by promoting EMT.

• Cell Migration: PLA2G7 has been implicated in promoting cell migration in cultured breast cancer cells , potentially contributing to metastatic processes.

Researchers studying PLA2G7 in the tumor microenvironment should consider using techniques such as single-cell RNA sequencing, flow cytometry, and in vitro co-culture systems to elucidate cell type-specific roles of PLA2G7 in cancer immunity.

How can pharmacological inhibition of PLA2G7 affect immune checkpoint blockade therapy?

Inhibiting PLA2G7 has shown promising effects in enhancing immunotherapy efficacy, particularly for immune checkpoint blockade:

• Enhanced ICB Efficacy: Pharmacological inhibition of PLA2G7 by darapladib has been demonstrated to improve the therapeutic efficacy of anti-programmed cell death protein 1 (anti-PD-1) antibodies in HCC mouse models . This suggests that PLA2G7 inhibition may serve as a strategy to overcome resistance to immune checkpoint blockade.

• Macrophage Reprogramming: PLA2G7 inhibition may reprogram macrophages away from an immunosuppressive phenotype, potentially restoring their ability to support anti-tumor immunity and T-cell activation .

• Combination Therapy Potential: In vivo studies have substantiated that darapladib enhances the susceptibility of HCC to anti-PD-1 therapy , introducing a promising strategy for combination therapy aimed at improving immunotherapy outcomes in HCC.

For researchers investigating PLA2G7 inhibition as a complementary approach to immunotherapy, it is important to consider:

• Dose-response relationships for PLA2G7 inhibitors

• Timing of PLA2G7 inhibition relative to immunotherapy administration

• Potential biomarkers for identifying patients likely to benefit from combined PLA2G7 inhibition and immunotherapy

• Assessment of immune cell infiltration and activation in the tumor microenvironment following treatment

What methodological considerations are important when quantifying PLA2G7 expression in clinical samples?

When quantifying PLA2G7 expression in clinical samples, several methodological considerations are crucial:

• Sample Processing: For protein quantification by ELISA, the recovery rates of PLA2G7 vary by sample type:

These data demonstrate that PLA2G7 can be reliably recovered from various biological sample types with good accuracy .

• Immunohistochemistry Scoring: For tissue samples, PLA2G7 protein expression can be evaluated by pathologists and graded based on staining intensity: low expression (no staining or weak staining) and high expression (moderate or strong staining) . Blinded evaluation by multiple pathologists is recommended to reduce bias.

• mRNA Quantification: For qRT-PCR analysis of PLA2G7 mRNA expression, the ΔΔCT method can be used with appropriate endogenous controls (e.g., β-actin) . Primer sequences that have been validated include:

  • PLA2G7 forward: tggctctaccttagaaccctga

  • PLA2G7 reverse: ttttgctctttgccgtacct

• Single-Cell Analysis: For detailed characterization of cell-specific PLA2G7 expression within heterogeneous samples, single-cell RNA sequencing is valuable, particularly for studying the tumor microenvironment .

• Normalization and Controls: When comparing PLA2G7 expression across different samples or conditions, proper normalization to housekeeping genes/proteins and inclusion of appropriate controls is essential for accurate interpretation.

What are the optimal conditions for using PLA2G7 antibodies in Western blotting protocols?

For optimal Western blotting results with PLA2G7 antibodies, researchers should consider the following:

How can researchers effectively use PLA2G7 antibodies for immunohistochemical analysis of cancer tissues?

For effective immunohistochemical (IHC) analysis of PLA2G7 in cancer tissues:

What are the critical parameters to optimize when developing a PLA2G7-specific ELISA assay?

When developing or optimizing a PLA2G7-specific ELISA assay, researchers should consider the following critical parameters:

• Antibody Pairing: For sandwich ELISA, select compatible capture and detection antibodies that recognize different epitopes of PLA2G7. For example, Mouse Anti-Human PLA2G7/PAF-AH/Lp-PLA2 Monoclonal Antibody (Clone #973005) has been validated as an ELISA capture antibody when paired with appropriate detection antibodies .

• Standard Curve: Use recombinant human PLA2G7 to generate a standard curve. E. coli-expressed recombinant human PLA2G7 has been shown to accurately quantitate the recombinant factor, and results obtained using natural human PLA2G7 showed linear curves that were parallel to the standard curves .

• Sample Types: Different biological samples may require specific optimization. Recovery rates for PLA2G7 have been evaluated in various sample types:

  • Cell Culture Media: 92% average recovery (range: 85-105%)

  • EDTA Plasma: 101% average recovery (range: 91-112%)

  • Heparin Plasma: 102% average recovery (range: 92-106%)

  • Serum: 106% average recovery (range: 91-115%)

• Dilution Linearity: Ensure that sample dilutions produce consistent results. Serial dilutions of samples should yield concentrations that fall along a linear curve when adjusted for the dilution factor.

• Sensitivity and Range: Optimize the assay to achieve the required sensitivity and dynamic range for the intended application. Commercial PLA2G7 Quantikine ELISA kits have established performance characteristics that can serve as a benchmark .

• Controls: Include appropriate positive and negative controls, as well as spike-in controls to assess recovery in different matrices.

• Cross-Reactivity: Validate the specificity of the assay by testing for potential cross-reactivity with related proteins, particularly other phospholipase A2 family members.

What emerging technologies might improve PLA2G7 detection and functional analysis in complex biological systems?

Several emerging technologies show promise for advancing PLA2G7 research:

• Spatial Transcriptomics and Proteomics: These techniques allow for the analysis of PLA2G7 expression and protein localization within the spatial context of tissues, providing insights into cell-cell interactions and microenvironmental influences on PLA2G7 function.

• CRISPR-Based Functional Genomics: High-throughput CRISPR screens can help identify genes that interact with PLA2G7 or modulate its effects on cellular phenotypes, potentially uncovering new therapeutic targets for combination approaches.

• Patient-Derived Organoids: These 3D culture systems can provide more physiologically relevant models for studying PLA2G7 function in human tissues and testing PLA2G7-targeting interventions.

• Single-Cell Multi-Omics: Integrating single-cell RNA sequencing with protein measurements and epigenetic profiling can provide comprehensive insights into the regulation and function of PLA2G7 in heterogeneous cell populations such as those found in tumors .

• Computational Approaches: Machine learning algorithms can help identify patterns in large datasets that may reveal new associations between PLA2G7 expression, genetic alterations, and clinical outcomes across different cancer types.

For researchers planning future studies on PLA2G7, considering these emerging technologies alongside established methods may provide more comprehensive insights into its biological roles and therapeutic potential.

How might combination approaches targeting PLA2G7 and other immune-regulatory pathways advance cancer immunotherapy?

The potential for combining PLA2G7 inhibition with other immunotherapeutic approaches represents an exciting frontier:

• Synergy with Immune Checkpoint Inhibitors: As demonstrated in HCC models, PLA2G7 inhibition can enhance the efficacy of anti-PD-1 therapy . Investigating combinations with other checkpoint inhibitors (anti-CTLA-4, anti-LAG-3, etc.) may reveal additional synergistic effects.

• Macrophage-Targeting Approaches: Since PLA2G7 is highly expressed in intratumoral macrophages , combining PLA2G7 inhibition with other macrophage-reprogramming strategies (e.g., CSF1R inhibitors) might more effectively reverse immunosuppression in the tumor microenvironment.

• Metabolic Modulation: Given PLA2G7's role in lipid metabolism, combining PLA2G7 inhibition with approaches targeting cancer metabolism may address multiple aspects of tumor growth and immune evasion simultaneously.

• Personalized Combination Strategies: Research into biomarkers that predict response to PLA2G7 inhibition (e.g., baseline PLA2G7 expression levels, macrophage infiltration patterns) could guide the development of personalized combination approaches for specific patient subgroups.

When designing studies to evaluate such combination approaches, researchers should carefully consider sequence, timing, and dosing to maximize therapeutic efficacy while minimizing potential toxicities.