PLEKHG5 Antibody

What is PLEKHG5 and what cellular functions does it perform?

PLEKHG5 functions as a guanyl-nucleotide exchange factor (GEF) that activates the NF-kappa-B signaling pathway and RHOA. It appears to be critically involved in the control of neuronal cell differentiation . At the molecular level, PLEKHG5 exhibits several key functions:

• Guanyl-nucleotide exchange factor activity

• Rho guanyl-nucleotide exchange factor activity

• Signal transducer activity

Cellular processes regulated by PLEKHG5 include:

• Positive regulation of apoptosis

• Positive regulation of GTPase activity

• Positive regulation of I-kappaB kinase/NF-kappaB signaling

• Regulation of Rho protein signal transduction

• Regulation of small GTPase mediated signal transduction

The protein is predominantly localized in the cytoplasm, cytosol, endocytic vesicles, intercellular junctions, lamellipodium, perinuclear region, and plasma membrane .

Which neurological disorders are associated with PLEKHG5 mutations?

PLEKHG5 mutations are causatively linked to several neurological disorders:

• Distal spinal muscular atrophy autosomal recessive type 4 (DSMA4): Characterized by childhood onset, generalized muscle weakness and atrophy with denervation and normal sensation. Bulbar symptoms and pyramidal signs are typically absent .

• Charcot-Marie-Tooth Disease, Recessive Intermediate C: A form of hereditary motor and sensory neuropathy .

The clinical presentation typically involves a classical distal muscular atrophy syndrome affecting the legs without clinical sensory loss. The disease progression pattern begins with weakness and wasting of distal muscles in the anterior tibial and peroneal compartments of the legs, potentially expanding to proximal muscles of the lower limbs and/or distal upper limbs as the condition advances .

What applications are suitable for PLEKHG5 antibodies in research?

PLEKHG5 antibodies have been validated for several experimental applications:

• Enzyme-Linked Immunosorbent Assay (ELISA): For quantitative detection of PLEKHG5 protein in research samples .

• Immunohistochemistry on paraffin-embedded tissues (IHC-P): Typically performed at a concentration of 1.5μg/ml. This application has been validated on human stomach tissue samples .

• Western Blot (WB): For detection of PLEKHG5 protein in cell lysates. This technique has successfully identified recombinant GST-tagged PLEKHG5 and can detect the immunogen at 37.11kD .

• Immunofluorescence (IF): Validated on HeLa cells at a concentration of 10μg/ml, allowing for subcellular localization studies .

These applications make PLEKHG5 antibodies valuable tools for investigating protein expression, localization, and function in various experimental contexts.

How can researchers validate PLEKHG5 antibody specificity?

Methodological approach for PLEKHG5 antibody validation:

• Western blot verification: Compare detection patterns against recombinant GST-tagged PLEKHG5 to confirm specificity for the target protein .

• Multiple tissue/cell type testing: Validate antibody performance across different experimental systems. For example, the antibody has been tested on human stomach tissue for IHC-P and HeLa cells for immunofluorescence .

• Concentration optimization: Different applications require distinct antibody concentrations (e.g., 1.5μg/ml for IHC-P versus 10μg/ml for IF) .

• Transfection controls: Compare antibody detection in cells transfected with PLEKHG5 expression vectors versus non-transfected cells. Wild-type PLEKHG5 protein is typically not visualized by western blotting or immunofluorescence before transfection but becomes detectable after transfection of expression vectors .

• Cross-validation with different detection methods: Verify consistency of results across multiple techniques such as western blotting, immunofluorescence, and IHC.

How does the c.1940 T→C mutation affect PLEKHG5 protein stability and function?

The c.1940 T→C mutation in PLEKHG5 causes significant alterations in both protein stability and function through multiple mechanisms:

• Protein instability: Mutant PLEKHG5 proteins are consistently undetectable by standard western blotting under conditions where wild-type proteins are readily visualized, suggesting severe destabilization of the mutant variants .

• Impaired detection by immunofluorescence:

  • Wild-type PLEKHG5: Diffusely localized in cytoplasm, detectable at standard exposure time (0.04s)

  • Mutant PLEKHG5: Barely detectable at standard exposure, requires longer exposure time (0.34s) to visualize a light, diffuse cytoplasmic signal

• Loss of NFκB pathway activation:

  • Wild-type PLEKHG5: Induces >6-fold higher luciferase activity in NFκB reporter assays compared to control cells

  • Mutant PLEKHG5: Shows markedly reduced luciferase activity induction despite similar transcript levels (verified by real-time quantitative RT-PCR showing 1000-fold increase in transcript abundance after transfection for both wild-type and mutant variants)

• Formation of protein aggregates: When expressed in NSC34 motor neuronal cells, mutant PLEKHG5 proteins form distinct aggregates in the motor neuron somas close to the nucleus in approximately 60-70% of transfected cells—a phenomenon not observed with wild-type PLEKHG5 .

These data collectively demonstrate that the c.1940 T→C mutation causes a significant loss-of-function through protein instability combined with a potential gain-of-toxic-function through aggregate formation in motor neurons.

What methods are available for studying PLEKHG5 isoforms?

Five isoforms of human PLEKHG5 are produced by alternative splicing . To effectively study these isoforms, researchers can employ the following methodological approaches:

• Isoform-specific PCR:
  The research literature provides detailed primer sequences targeting specific exons of different PLEKHG5 isoforms (NM_198681, NM_020631, NM_001042663, NM_001042664, NM_001042665). For example:

  Isoform (GenBank Accession)	Forward Primer	Reverse Primer
  Exon 1 (NM_198681)	TCTGTGGTGTTGCTTTCCTG	GCCTGCAAGTGGCTCTTAAA
  Exon 1 (NM_020631)	TCAGAGTTCCCTTGCAGCTT	GGGACCAGTCACTTCCAGAG
  Exon 1 (NM_001042663)	TGGAAACTGACCTCGGAGAC	CCCGGAGGAGGTTAGGAG
  Exon 1 (NM_001042664)	GCGCGGCTACCGTAATTC	TTCTGTCCATCGGTTTAGGG
  Exon 1 (NM_001042665)	GCTCCACAGTCTCCAAGGTG	GGACTCCACACCCCTACCTC

  Additional primers for different exons are available for comprehensive isoform analysis .

• Expression vector systems:

  • Full-ORF expression clones containing complete coding cDNA for specific isoforms (e.g., BC042606 or BC015231) can be utilized

  • These sequence-verified constructs allow controlled expression and comparison of individual isoforms

• Protein detection:

  • Western blotting can distinguish isoforms based on molecular weight differences

  • BC015231 and BC042606 isoforms appear as 130 kDa and 150 kDa fragments, respectively, when detected with anti-PLEKHG5 antibodies

• Functional analysis:

  • Different isoforms can be tested for their specific functional capabilities, such as activation of the NFκB pathway

  • Luciferase reporter assays can quantitatively measure the relative activity of different isoforms

These approaches enable comprehensive characterization of the expression patterns, subcellular localization, and functional properties of different PLEKHG5 isoforms.

How can researchers effectively investigate PLEKHG5's role in NFκB signaling?

To effectively investigate PLEKHG5's role in the NFκB signaling pathway, researchers can implement the following experimental approaches:

• Luciferase reporter assays:

  • Transfect cells with an NFκB-responsive luciferase reporter construct together with PLEKHG5 expression vectors

  • Measure luciferase activity as a quantitative readout of NFκB pathway activation

  • Compare activity between wild-type and mutant PLEKHG5 variants or between different isoforms

  • Research has shown that wild-type PLEKHG5 induces >6-fold higher luciferase activity compared to control cells

• Expression verification:

  • Confirm PLEKHG5 expression levels using real-time quantitative RT-PCR

  • Studies have demonstrated up to 1000-fold increase in PLEKHG5 transcript abundance after transfection

  • This control ensures that differences in NFκB activation are not simply due to different expression levels of the constructs

• Cellular models:

  • HEK293 and MCF10A cell lines have been successfully used for NFκB pathway activation studies

  • NSC34 murine motor neuron-like cells provide a more neuronally relevant context for studying PLEKHG5 function

• Mutation analysis:

  • Introduce specific mutations (such as the c.1940 T→C mutation) into PLEKHG5 expression constructs

  • The methodology includes:
    a) Amplifying cDNA with primers framing the mutation
    b) Restricting the mutated cDNA amplification product and expression vectors with specific endonucleases (e.g., BstEII and PflMI)
    c) Ligating the fragments and screening for the mutated insert
    d) Verifying the absence of additional mutations by sequencing analysis

• Protein stability assessment:

  • Perform western blotting to determine if mutations affect protein stability

  • Use polyclonal antibodies generated against specific PLEKHG5 peptides (e.g., NH2-CYLRVKAPAKPGDEG-CONH2 and NH2-CKVDIYLDQSNTPLSL-CONH2)

  • Prepare cell extracts in appropriate buffers (e.g., 0.32 M sucrose or lysis buffer containing 10 mM Hepes, 10 mM KCl, 2 mM MgCl2, 0.1 mM EDTA, and 1 mM dithiothreitol with 10% Nonidet P40)

These methodological approaches enable comprehensive investigation of PLEKHG5's role in NFκB signaling and how disease-associated mutations impact this function.

What experimental models are most suitable for studying PLEKHG5 in motor neuron diseases?

For investigating PLEKHG5's role in motor neuron diseases, researchers should consider these experimental model systems and methodological approaches:

• NSC34 murine motor neuron-like cells:

  • Advantages: Express motor neuron characteristics, allow for transfection of PLEKHG5 constructs, suitable for studying protein aggregation and subcellular localization

  • Applications: Studies have successfully demonstrated formation of mutant PLEKHG5 aggregates in 60-70% of transfected cells, with aggregates forming in motor neuron somas close to the nucleus

  • Detection method: Immunofluorescence using polyclonal anti-PLEKHG5 antibody (1:100) coupled with nuclear staining, followed by rhodamine (A-594)-conjugated anti-rabbit secondary antibody (1:800)

• Human cell lines (HEK293, MCF10A, HeLa):

  • Advantages: Easily transfectable, suitable for basic mechanistic studies

  • Applications: Western blotting, immunofluorescence, reporter assays

  • Detection protocols:

    • Western blot: Cell lysates prepared in 0.32 M sucrose or lysis buffer with protease inhibitors, samples boiled in Laemmli buffer, separated by 7.5% SDS-PAGE, and probed with anti-PLEKHG5 antibodies (1:1,000)

    • Immunofluorescence: Cells fixed in 4% formaldehyde, permeabilized with 1% Triton X-100, blocked in 5% nonfat milk, and incubated with anti-PLEKHG5 antibodies (1:100) followed by fluorescein isothiocyanate-conjugated secondary antibody (1:1,000)

• Patient-derived fibroblasts:

  • Advantages: Contain naturally occurring mutations, allowing study of endogenous PLEKHG5

  • Methods: mRNA can be extracted using standardized protocols (e.g., RNeasy from Qiagen), followed by RT-PCR using oligo(dT) and random hexamers (e.g., Transcriptor First Strand cDNA Synthesis Kit)

• Expression vectors and constructs:

  • Full-ORF expression clones containing complete coding cDNA for isoforms (e.g., BC042606 or BC015231)

  • Mutagenesis approach: Amplify cDNA with primers framing the mutation, restrict with appropriate endonucleases, ligate into expression vectors, and verify by sequencing

• Functional assessment:

  • NFκB pathway activation using luciferase reporter assays

  • Protein stability and aggregation analysis by western blotting and immunofluorescence

  • Confocal microscopy for detailed characterization of protein localization and aggregation

These models and approaches provide complementary insights into PLEKHG5 function and how mutations lead to motor neuron pathology.

How can researchers detect and analyze PLEKHG5 protein aggregation in neuronal models?

To effectively detect and analyze PLEKHG5 protein aggregation in neuronal models, researchers should employ these methodological approaches:

• Cell model selection:

  • NSC34 murine motor neuron-like cells have proven effective for studying PLEKHG5 aggregation

  • These cells recapitulate key features of motor neurons and allow for efficient transfection with PLEKHG5 constructs

• Transfection protocol:

  • Transiently transfect cells with wild-type or mutant PLEKHG5 constructs (e.g., c.1940 T→C mutant)

  • Co-transfection with GFP can help identify successfully transfected cells

  • Allow 48 hours post-transfection for optimal protein expression and potential aggregate formation

• Immunofluorescence detection:

  • Fix cells in 4% formaldehyde

  • Permeabilize with appropriate detergent (e.g., 1% Triton X-100)

  • Block non-specific binding (e.g., with 5% nonfat milk)

  • Incubate with primary anti-PLEKHG5 antibody (1:100 dilution has been validated)

  • Apply fluorescent secondary antibody (e.g., rhodamine (A-594)-conjugated anti-rabbit antibody at 1:800)

  • Counter-stain nuclei with DAPI to establish subcellular localization of aggregates

• Confocal microscopy analysis:

  • Use confocal microscopy for high-resolution imaging of PLEKHG5 aggregates

  • This approach allows precise localization of aggregates relative to cellular structures

  • Research has shown that mutant PLEKHG5 forms aggregates specifically in motor neuron somas close to the nucleus

• Quantitative assessment:

  • Calculate the percentage of transfected cells containing aggregates (60-70% reported for c.1940 T→C mutation)

  • Compare wild-type and mutant proteins under identical experimental conditions

  • This provides a quantifiable phenotype for comparing different mutations or treatments

• Biochemical verification:

  • Complement imaging with western blot analysis of protein levels

  • Compare expression levels between wild-type and mutant proteins

  • Research has shown that mutant PLEKHG5 proteins accumulate at much lower levels than wild-type proteins, confirming their instability

This multi-faceted approach provides comprehensive characterization of PLEKHG5 aggregation, potentially revealing mechanisms underlying motor neuron pathology in PLEKHG5-associated neurological disorders.

What are the optimal methods for introducing PLEKHG5 mutations for functional studies?

For introducing and studying PLEKHG5 mutations in experimental systems, researchers should follow these methodological approaches:

• Site-directed mutagenesis protocol:

  • Amplify cDNA of interest using primers that frame the desired mutation site

  • For studying the c.1940 T→C mutation, specific primers have been successfully used (details available in the referenced research)

  • Restrict both the mutated cDNA amplification product and the full-ORF expression clone with appropriate endonucleases (e.g., BstEII and PflMI)

  • Ligate the fragments to create the mutant construct

  • Screen colonies for the presence of the mutated insert

  • Verify the absence of additional unintended mutations by complete sequencing analysis

• Expression vectors and constructs:

  • Start with sequence-verified full-ORF expression clones containing complete coding cDNA (e.g., PLEKHG5 isoforms BC042606 or BC015231)

  • These can be obtained from repositories such as the Deutsches Ressourcenzentrum für Genomforschung (RZPD)

• Control constructs:

  • Include appropriate control plasmids in experiments (e.g., pCMVlacZ)

  • These can be constructed by inserting coding regions (such as E. coli lacZ) into suitable expression vectors (like pCMX-PL1)

• Transfection optimization:

  • Different cell types may require specific transfection protocols

  • Common cell lines used for PLEKHG5 studies include HEK293, MCF10A, and NSC34 cells

  • Allow 48 hours post-transfection for optimal protein expression before analyses

• Verification approaches:

  • Transcript level: Use real-time quantitative RT-PCR to confirm similar expression levels between wild-type and mutant constructs

  • Protein expression: Western blotting with anti-PLEKHG5 antibodies

  • Cellular localization: Immunofluorescence analysis

  • Functional assessment: Luciferase reporter assays for NFκB pathway activation

• Cell-type specific considerations:

  • For neuronal relevance, NSC34 murine motor neuron-like cells are particularly valuable

  • These cells allow observation of neuron-specific phenotypes, such as the formation of PLEKHG5 aggregates in motor neuron somas

  • For general functional studies, HEK293 and MCF10A cells provide robust expression systems

This comprehensive approach ensures reliable introduction and functional characterization of PLEKHG5 mutations, facilitating understanding of their pathological mechanisms.

How can researchers generate and validate antibodies against PLEKHG5?

For researchers developing antibodies against PLEKHG5, the following methodological approach has been successfully implemented:

• Peptide design:

  • Select specific peptide sequences unique to PLEKHG5

  • Successful examples from published research include:

    • NH2-CYLRVKAPAKPGDEG-CONH2

    • NH2-CKVDIYLDQSNTPLSL-CONH2

  • These peptides should be designed to target accessible regions of the protein while avoiding highly conserved domains shared with other proteins

• Immunization protocol:

  • Immunize rabbits with the synthesized specific peptides

  • A standard protocol involves immunizing multiple animals (e.g., two rabbits) to ensure reliable antibody production

• Antibody purification:

  • Purify the resulting polyclonal antibodies on a sepharose column

  • This affinity purification step enhances specificity by isolating antibodies that bind strongly to the target peptides

• Validation by ELISA:

  • Confirm high reactivity of immunopurified antibodies using ELISA

  • This quantitative assessment provides the first verification of antibody quality

• Western blot validation:

  • Test antibody specificity by western blotting using:

    • Cell lysates from cells transfected with PLEKHG5 expression vectors

    • Control lysates from non-transfected cells

  • Expected results: Detection of appropriate size bands (e.g., 130 kDa and 150 kDa fragments for BC015231 and BC042606 isoforms) in transfected but not in non-transfected samples

• Optimization for different applications:

  • Western blotting: 1:1,000 dilution has been validated

  • Immunofluorescence: 1:100 dilution has proven effective

  • Immunohistochemistry: 1.5μg/ml concentration for paraffin-embedded tissues

• Cross-validation across multiple techniques:

  • Ensure consistent detection across western blotting, immunofluorescence, and immunohistochemistry

  • This comprehensive validation confirms antibody reliability across different experimental contexts

These methodological steps ensure the generation of high-quality, specific antibodies against PLEKHG5 that can be reliably used across multiple experimental applications.

What PLEKHG5 research findings are most relevant for therapeutic development?

Several key PLEKHG5 research findings have significant implications for therapeutic development strategies:

• Protein stability mechanism:

  • The c.1940 T→C mutation causes severe protein instability, as demonstrated by western blotting showing significantly reduced protein levels despite normal transcript abundance

  • This suggests that stabilizing mutant PLEKHG5 protein could be a therapeutic approach

• Aggregate formation in motor neurons:

  • Mutant PLEKHG5 proteins form distinct aggregates in motor neuron somas in 60-70% of NSC34 cells

  • These aggregates are specifically located close to the nucleus

  • Targeting protein aggregation through chaperone induction or aggregate clearance could be therapeutically beneficial

• NFκB pathway dysfunction:

  • Wild-type PLEKHG5 activates the NFκB pathway (>6-fold higher luciferase activity)

  • Mutant PLEKHG5 shows markedly reduced NFκB activation

  • This suggests that targeted activation of the NFκB pathway downstream of PLEKHG5 could compensate for this loss of function

• Multiple cellular functions:

  • PLEKHG5 has diverse roles including:

    • Guanyl-nucleotide exchange factor activity

    • Regulation of apoptosis

    • Positive regulation of I-kappaB kinase/NF-kappaB signaling

    • Regulation of Rho protein signal transduction

  • This multi-functionality suggests that targeted therapies may need to address specific pathways rather than general PLEKHG5 replacement

• Disease specificity:

  • PLEKHG5 mutations cause distinct neurological conditions including:

    • Distal spinal muscular atrophy autosomal recessive type 4 (DSMA4)

    • Charcot-Marie-Tooth Disease, Recessive Intermediate C

  • The selective vulnerability of specific neuronal populations suggests unique therapeutic requirements for different PLEKHG5-associated disorders

• Isoform-specific considerations:

  • Five isoforms of human PLEKHG5 are produced by alternative splicing

  • These may have distinct functions and expression patterns in different tissues

  • Therapeutic approaches may need to target specific isoforms relevant to disease pathology

These research findings collectively inform therapeutic strategies ranging from protein stabilization and aggregate clearance to pathway-specific interventions, providing multiple potential avenues for treating PLEKHG5-associated neurological disorders.