Customize atgl-1 Antibody

Description

Introduction to ATGL Antibodies

ATGL antibodies are immunochemical reagents designed to detect and quantify the ATGL protein, which catalyzes the hydrolysis of triacylglycerols (TAGs) to diacylglycerols (DAGs) in lipid droplets . These antibodies are critical for understanding ATGL's regulatory mechanisms in lipid metabolism, its interaction partners (e.g., CGI-58, perilipin), and its implications in metabolic disorders like obesity and neutral lipid storage disease .

Product Examples

Product Name	Host Species	Reactivity	Applications	Dilution Range
ATGL/PNPLA2 Rabbit mAb (CAB5126)	Rabbit	Human, Mouse, Rat	WB, IHC, ELISA	WB: 1:500–1:1000
ATGL Antibody #55190-1-AP	Rabbit	Human, Mouse, Rat	WB, IHC, IF, IP	WB: 1:500–1:1000
ATGL (30A4) Rabbit mAb #2439	Rabbit	Mouse	WB, IP, IHC, IF	WB: 1:1000

Immunogen Design

Most ATGL antibodies are generated using recombinant peptides or fusion proteins. For example, CAB5126 targets amino acids 300–394 of human ATGL, while #55190-1-AP uses a peptide sequence conserved across species .

Research Applications

ATGL antibodies are widely used in:

Western Blot (WB): Detects ATGL at ~45–55 kDa in tissues like heart, skeletal muscle, and liver .
Immunohistochemistry (IHC): Localizes ATGL in lipid droplets of adipocytes and cancer cells .
Functional Studies: Evaluates ATGL’s role in cancer proliferation (e.g., hepatocellular carcinoma) .

Metabolic Disorders

ATGL dysfunction, detected via antibody-based assays, is linked to neutral lipid storage disease (NLSDM), characterized by TAG accumulation in granulocytes . Antibody studies reveal reduced ATGL expression in NLSDM patients, correlating with impaired lipolysis .

Cancer Research

Pro-Tumor Effects: ATGL overexpression in HepG2 and Hep3B hepatocellular carcinoma cells promotes proliferation via p-Akt phosphorylation .
Anti-Tumor Effects: In lung cancer models, ATGL deficiency reduces tumor growth, highlighting its context-dependent roles .

Therapeutic Targeting

ATGL antibodies aid in evaluating inhibitors (e.g., G0S2) for metabolic and cancer therapies .

Table 1: Primer Sequences for ATGL Studies

Gene	Forward Primer	Reverse Primer
ATGL	ACCAGCATCCAGTTCAACCT	ATCCCTGCTTGCACATCTCT
CGI-58	TGCAGACTCCAAGTGGTGAG	TGTCAGGGTGCATTTTACCA

Table 2: Clinical Correlations of ATGL Expression

Variable	Adipose ATGL mRNA	Muscle ATGL mRNA
BMI	0.21	0.14
Plasma adiponectin	-0.27	0.20
Adipose CGI-58 mRNA	0.70*	NA

Product Specs

Buffer

Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4

Form

Liquid

Lead Time

Made-to-order (14-16 weeks)

Synonyms

atgl-1 antibody; C05D11.7 antibody; Patanin-like phospholipase domain-containing protein antibody; EC 3.1.1.3 antibody; Adipose triglyceride lipase 1 antibody

Target Names

atgl-1

Uniprot No.

Q11186

Target Background

Function

Atgl-1 antibody catalyzes the initial step in triglyceride hydrolysis within both adipocyte and non-adipocyte lipid droplets. It is a component of a feedback loop involving atfs-1, atgl-1 and hlh-11. This antibody promotes fat oxidation in response to mitochondrial stress. It may play a role in the organism's response to starvation by enhancing the hydrolysis of triglycerides and providing free fatty acids to other tissues for oxidation in energy depletion situations. Atgl-1 acts in concert with lid-1 within the lipolytic cascade to distribute stored energy throughout the body. Together with lipid droplet protein cgi-58, Atgl-1 regulates lipid reserves as well as lipid droplet size and localization during the dauer phase in response to phosphorylation by AMP-activated protein kinase (AMPK). This antibody may regulate serotonin-mediated lipolysis in metabolic tissues.

Database Links

STRING: 6239.C05D11.7b.2

UniGene: Cel.8627

Subcellular Location

Lipid droplet. Cell membrane; Single-pass type II membrane protein. Cytoplasm.

Tissue Specificity

Expressed in the hypodermis. Expressed in the intestine (at protein level).

Q&A

FAQs for Researchers on ATGL-1 Antibody in Academic Research

Advanced Research Questions

How to resolve discrepancies in ATGL-1 expression levels across cell models?

Analysis Framework:

Factor	Impact on ATGL-1	Example
Differentiation state	ATGL increases during adipogenesis (e.g., 30-fold in 3T3-L1 cells )	Use qPCR to correlate protein and mRNA levels.
Hormonal regulation	Insulin downregulates ATGL, while fasting upregulates it	Pre-treat cells with insulin (100 nM, 24 hr) for comparative studies.

Troubleshooting: Normalize to housekeeping proteins validated in your model (e.g., tubulin in 3T3-L1 cells ).

What mechanisms underlie ATGL-1’s dual lipase/transacylase activities, and how to study them?
- Experimental Design:
  - Lipase Activity: Measure glycerol/NEFA release in ATGL-overexpressing cells . Inhibit activity with 10 µM atglistatin .
  - Transacylase Activity: Quantify FAHFA biosynthesis via LC-MS in wild-type vs. Atgl KO adipocytes .
- Key Controls: Include catalytically dead ATGL mutants (e.g., Ser47Ala) to confirm enzymatic specificity .
How to interpret conflicting data on ATGL-1’s role in lipid droplet dynamics?
- Case Study:
  - Observation: ATGL knockdown increases lipid droplet size in FSP27-depleted cells .
  - Resolution: Context-dependent roles arise from interplay with partners (e.g., perilipin 1 inhibits ATGL, while FSP27 modulates its localization ). Use co-IP/microscopy to map interactions under varying metabolic states.

Methodological Best Practices

Multiplex staining compatibility with ATGL-1 antibody
- Guidelines:
  - Use species-matched secondary antibodies (e.g., anti-rabbit Alexa Fluor 488 for ATGL; anti-mouse Alexa Fluor 594 for co-stains ).
  - Sequential staining to prevent cross-reactivity.
Quantifying ATGL-1 in low-abundance samples (e.g., human biopsies)
- Enhancement Strategies:
  - Signal amplification systems (e.g., tyramide-based).
  - Pre-fractionate lysates via sucrose density centrifugation to enrich lipid droplet fractions .

Data Contradiction Analysis

Why do studies report varying ATGL-1 molecular weights?
- Root Causes:
  
  Source Band Size Explanation
  Proteintech 45–55 kDa Isoforms or degradation during extraction.
  Abcam 55 kDa Full-length protein under optimized conditions (8-min exposure).
- Mitigation: Include positive controls (e.g., 3T3-L1 adipocyte lysate) and protease inhibitors during sample prep.
Discrepancies in ATGL-1-mediated lipolysis across genetic models
- Hypothesis Testing:
  - Model-Specific Effects: Adipose-specific Atgl KO reduces FAHFAs by 80–90% , while whole-body KO may have compensatory mechanisms.
  - Experimental Adjustments: Use tissue-specific promoters or inducible KO systems to isolate effects.

Source	Band Size	Explanation
Proteintech	45–55 kDa	Isoforms or degradation during extraction.
Abcam	55 kDa	Full-length protein under optimized conditions (8-min exposure).

Quick Inquiry

Personal Email Detected

Please use an institutional or corporate email address for inquiries. Personal email accounts ( such as Gmail, Yahoo, and Outlook) are not accepted. *

Name*

Email*

Phone

Country

Source

Quantity&Size*

Product Name

Message

atgl-1 Antibody