At1g11920 Antibody
Description
Nomenclature Analysis
The identifier "At1g11920" follows Arabidopsis thaliana (a model plant species) gene nomenclature conventions, where:
-
At: Arabidopsis thaliana
-
1g: Chromosome 1
-
11920: Unique locus identifier
Search Result Review
The provided sources focus on antibodies targeting human receptors (e.g., angiotensin II receptor, endothelin receptor) or pathogens (e.g., HIV, SARS-CoV-2). Key findings from these sources include:
-
Antibody specificity for GPCRs like AT1R and ETAR in COVID-19 patients .
-
Structural insights into HIV-neutralizing antibodies like N6 .
-
Germline-encoded determinants of antibody homotypic interactions .
None mention Arabidopsis thaliana proteins or plant-specific antibodies.
Hypothesis 1: Typographical Error
If the intended target was AT1R (Angiotensin II Receptor Type 1), extensive data exists (e.g., ):
| Property | Anti-AT1R Antibody (AAR-011) |
|---|---|
| Target | Human AT1R extracellular domain |
| Applications | WB, IHC, Flow Cytometry |
| Species Reactivity | Human, Mouse, Rat |
| Associated Diseases | Hypertension, COVID-19 |
Hypothesis 2: Obscure or Proprietary Antibody
If "At1g11920 Antibody" refers to a proprietary reagent, it may not be published or cataloged in public databases.
Recommendations for Further Investigation
-
Verify the compound name for typographical errors (e.g., AT1R vs. At1g11920).
-
Consult Arabidopsis-centric resources:
-
TAIR (The Arabidopsis Information Resource) for gene annotations.
-
ABRC (Arabidopsis Biological Resource Center) for antibodies.
-
-
Explore cross-reactivity: Plant FLAs share structural motifs with mammalian proteins, but no cross-reactive antibodies are documented in the provided sources.
Product Specs
Composition: 50% Glycerol, 0.01M Phosphate Buffered Saline (PBS), pH 7.4
Q&A
Here’s a structured collection of FAQs tailored for researchers working with the At1g11920 Antibody in plant molecular biology, integrating experimental design principles and data analysis challenges:
Advanced Research Questions
-
How to resolve contradictions between transcriptomic and proteomic data for At1g11920 under nanoparticle stress?
-
Case study: In AuNP-SCTA-treated Arabidopsis:
Analysis Type Fold Change (6h) Fold Change (7d) RNA-seq +2.1 -1.8 Proteomics No change -3.2 -
Resolution workflow:
-
Verify antibody performance in stressed samples
-
Perform ribosome profiling to assess translational efficiency
-
Test protein degradation rates via cycloheximide chase assays
-
-
-
What multi-omics strategies best characterize At1g11920's role in cell wall remodeling?
Technical Optimization Questions
-
How to design CRISPR mutants for functional validation of At1g11920 antibodies?
-
Guide RNA design:
Target Exon sgRNA Sequence (5'-3') Off-Target Score Exon 2 GACCTGCGATCAGCTCAACG 94 Exon 4 TCCGATACGGCTACGTACAA 88 -
Validation triad:
-
Antibody signal loss in mutants
-
Complementation assay rescue
-
Phenotypic correlation with cell wall defects
-
-
-
What statistical frameworks are robust for time-series analysis of At1g11920 expression?
Data Interpretation Challenges
-
How to distinguish between direct antibody recognition artifacts and true biological variation?
