POLD4 Human

What is POLD4 and what is its role in DNA replication?

POLD4 encodes the smallest subunit (p12) of the DNA polymerase delta complex, which is essential for DNA replication in mammalian cells. Research demonstrates that POLD4 is required for optimal in vitro polymerase delta activity, even in the presence of the accessory protein PCNA (Proliferating Cell Nuclear Antigen) . As part of the polymerase delta complex, POLD4 contributes to faithful DNA replication during the S-phase of the cell cycle. Experimental evidence shows that reduction of POLD4 results in decreased colony formation activity in multiple cell lines (including Calu6, ACC-LC-319, and PC-10), indicating its importance in cell proliferation .

Methodological approach for studying POLD4's role in replication:

• In vitro polymerase activity assays with and without POLD4

• Cell proliferation assays with POLD4 knockdown cells

• Colony formation assays to assess long-term survival

How does POLD4 contribute to genomic stability?

POLD4 plays a crucial role in maintaining genomic stability in human cells. Studies show that shRNA-mediated reduction of POLD4 is associated with an increased population of karyomere-like cells, which indicates DNA replication stress and/or DNA damage . Interestingly, these karyomere-like cells retain the ability to progress through the cell cycle, suggesting that POLD4 reduction induces modest genomic instability while allowing cells to continue dividing until DNA damage reaches an intolerable level . This progressive accumulation of genomic instability may explain the correlation between POLD4 expression and cancer outcomes.

Research approaches to study POLD4's role in genomic stability:

• Karyomere formation analysis in POLD4-depleted cells

• Cell cycle progression studies combined with DNA damage markers

• Long-term culture experiments to track genomic instability accumulation

What analytical methods are most effective for quantifying POLD4 expression in clinical samples?

For accurate quantification of POLD4 expression in clinical samples, researchers have successfully employed multiple complementary techniques:

• Quantitative Real-Time PCR (qPCR): Using primers specific for POLD4 (forward: TGTGAAGAGGAGGGAGGGG, reverse: TGCCAGGCCAGGTCAAACT) with GAPDH as internal control (forward: AAAAGCATCACCCGGAGGAGAA, reverse: AAGGAAATGAATGGGCAGCCG). The −ΔΔCTmethod is applied to quantify expression levels .

• Immunohistochemistry (IHC): For protein-level detection in tissue samples, enabling spatial visualization of expression patterns and quantification using Integrated Optical Density (IOD) measurements .

• Analysis of public datasets: Leveraging TCGA, GTEx, and CCLE databases to compare expression levels across tissue types and disease states .

The combination of these methods provides robust validation of expression patterns at both RNA and protein levels.

How is POLD4 expression altered across different cancer types?

POLD4 exhibits significant upregulation across multiple cancer types compared to corresponding normal tissues. Comprehensive analysis using TCGA and GTEx databases reveals:

The consistent upregulation across diverse cancer types suggests POLD4 may serve as a generalized oncogenic factor, potentially through its involvement in DNA replication and repair mechanisms . Expression analysis in tumor cell lines from the CCLE database further confirms elevated POLD4 expression in cancer cell models .

For experimental validation, qPCR analysis demonstrated significantly higher POLD4 expression in glioma cell lines (T98G, U87, A172, LN229, and U251) compared to normal human astrocyte cell lines (NHA), as well as in glioma tissues compared to adjacent normal brain tissues .

What is the prognostic significance of POLD4 expression in cancer?

POLD4 expression levels demonstrate significant prognostic value across multiple cancer types and survival endpoints:

Specifically for gliomas, survival analysis in multiple independent databases (CGGA_mRNAseq_325, CGGA_mRNAseq_693, CGGA_array_301, and Rembrandt) consistently shows that POLD4-high patients have significantly worse survival outcomes compared to POLD4-low patients .

These findings suggest POLD4 expression could serve as an important prognostic biomarker, particularly in brain tumors.

What functional mechanisms explain POLD4's role in cancer progression?

POLD4 promotes cancer progression through multiple mechanisms:

• Enhanced cell proliferation: Experimental evidence from CCK8 assays, colony formation assays, and EDU uptake experiments demonstrates that POLD4 knockdown significantly reduces proliferation capacity of glioma cells (U251 and U87) . In vivo studies using bioluminescence imaging to monitor U87 intracranial tumorigenesis after POLD4 knockdown further confirm this effect .

• Gene set enrichment analysis (GSEA) reveals POLD4-related genes in gliomas are significantly enriched in cell cycle regulation, DNA replication, and mitotic processes .

• Immunohistochemical analysis shows positive correlation between POLD4 and PCNA (a proliferation marker) expression in glioma tissues .

• Modest genomic instability: POLD4 reduction induces karyomere-like cells, indicating DNA replication stress, yet allows continued cell cycle progression, potentially leading to accumulation of mutations that drive cancer progression .

How does POLD4 influence the tumor immune microenvironment?

POLD4 expression shows significant correlations with tumor immune microenvironment characteristics:

• Tumor purity: Negative correlation between POLD4 expression and tumor purity across multiple cancer types .

• Stromal and immune scores: Positive correlation with both stromal and immune scores, suggesting POLD4 associates with increased non-tumor cell infiltration .

• Specific immune cell populations: POLD4 expression correlates with infiltration of specific immune cell types as assessed using the ImmuCellAI database. Particularly in gliomas, high POLD4 expression associates with increased immunosuppressive cells (including regulatory T cells, tumor-associated macrophages) .

• Immunosuppressive markers: Histological analysis reveals positive correlation between POLD4 expression and immunosuppressive markers CD163, CD206, and PDL1 in glioma tissues .

• Chemokine and receptor genes: POLD4 expression correlates with specific chemokine-receptor genes that influence immune cell trafficking .

These findings suggest POLD4 may promote an immunosuppressive tumor microenvironment, potentially enabling cancer immune evasion.

What is the role of iron-sulfur clusters in POLD4 function and human DNA polymerase delta activity?

Recent research indicates that human DNA polymerase delta requires an iron-sulfur (FeS) cluster for optimal activity . While the specific relationship between POLD4 and FeS clusters isn't fully detailed in the available search results, the research indicates:

• FeS clusters play a critical role in polymerase/primase activity, which is an "area of intense research" .

• The fundamental question centers on whether FeS clusters have primarily structural or functional (potentially redox-active) roles in polymerase complexes .

• Since POLD4 is an essential component of the polymerase delta complex, understanding how FeS clusters influence the entire complex is crucial for comprehending POLD4's molecular functions.

Research methodologies would involve:

• Structural studies comparing polymerase delta with and without FeS clusters

• Functional assays measuring polymerase activity under varying redox conditions

• Mutation studies targeting amino acids involved in FeS cluster coordination

What are effective methods for POLD4 knockdown in experimental models?

Based on successful experimental approaches documented in the literature:

• shRNA interference: Lentiviral particles containing targeted shRNA constructs for POLD4 have been effectively used to establish stable knockdown cell lines . The basic protocol involves:

  • Transduction of target cells with lentiviral particles containing POLD4-specific shRNA

  • Selection of stable knockdown cells using puromycin

  • Validation of knockdown efficiency using qPCR with specific primers (see question 3)

• In vivo models: For studying POLD4's role in tumorigenesis, researchers have successfully used:

  • U87MG cells stably expressing firefly luciferase (Fluc) with POLD4 knockdown

  • Stereotactic implantation into mouse brain

  • Monitoring of tumor progression using bioluminescence imaging (Bruker Corporation system)

These approaches have successfully demonstrated POLD4's functional role in promoting glioma cell proliferation both in vitro and in vivo.

How can researchers investigate the relationship between POLD4 and response to cancer therapy?

To study POLD4's impact on therapy response, researchers have employed several approaches:

• Correlation with immunotherapy response:

  • TIDE (Tumor Immune Dysfunction and Exclusion) analysis to compare POLD4 expression between responders and non-responders

  • Analysis of clinical cohorts (IMvigor210, GSE91061) to correlate POLD4 expression with actual immunotherapy outcomes

  • Measurement of TIDE scores, Merck18 scores, dysfunction scores, and exclusion scores in POLD4-high versus POLD4-low patient groups

• Drug sensitivity analysis:

  • Correlation of POLD4 expression with sensitivity to various anticancer drugs

  • Testing drug efficacy in POLD4 knockdown versus control cancer cells

• Combination therapy approaches:

  • Testing whether POLD4 inhibition might sensitize cancer cells to existing therapies

  • Investigating synergistic combinations targeting both POLD4 and related pathways

These approaches provide a methodological framework for investigating whether POLD4 status might predict therapy response or serve as a therapeutic target itself.

What are the emerging areas of POLD4 research that need further investigation?

Several promising research directions emerge from current POLD4 knowledge:

These research areas represent critical knowledge gaps that, when addressed, may yield important clinical applications for cancer diagnosis, prognosis, and treatment.

How might POLD4 research contribute to personalized cancer treatment strategies?

POLD4 research has several potential applications in personalized oncology:

• Patient stratification: POLD4 expression profiles might help identify patients likely to benefit from specific therapeutic approaches, particularly immunotherapy, based on the correlation between POLD4 expression and immunotherapy response markers .

• Combination therapy design: Understanding POLD4's multiple roles in proliferation and immune modulation could inform rational combination therapies targeting both aspects.

• Monitoring treatment response: Changes in POLD4 expression during treatment might serve as an early indicator of therapeutic efficacy or resistance development.

• Novel therapeutic target: The essential role of POLD4 in cancer cell proliferation makes it a potential target for cancer-specific therapies, especially in tumors with high POLD4 expression.

The multifaceted functions of POLD4 in cancer biology position it as a valuable subject for translational research aimed at improving clinical outcomes through personalized treatment approaches.