EMB1006 Antibody

What is EMB1006 and why is it significant for plant research?

EMB1006 (AT5G50280) is an Arabidopsis P-type PPR protein containing 11 PPR motifs that plays a critical role in plastid intron splicing. It is particularly significant because knockout mutants display an embryo-lethal phenotype that arrests at the globular stage, indicating its essential role in plant development . EMB1006 facilitates the splicing of several plastid introns, including clpP1 intron 2, rps12 intron 2, ycf3 intron 1, and ndhA intron . The protein is ubiquitously expressed in plant tissues but shows higher expression in green tissues such as leaves, siliques, stems, and inflorescences, suggesting its importance in photosynthetic function .

How can I detect EMB1006 protein in plant tissues?

EMB1006 can be detected using immunoblotting techniques with tagged fusion proteins. In research studies, EMB1006-Myc fusion proteins have been successfully detected using monoclonal antibodies against the Myc tag . When designing your experiment:

• Create a fusion construct (e.g., EMB1006-Myc) under a suitable promoter

• Transform the construct into plant tissues or cells

• Extract total protein from transformed tissue

• Perform SDS-PAGE separation followed by immunoblotting

• Use appropriate antibodies (anti-Myc for tagged constructs)

The subcellular localization can be confirmed through fluorescent protein fusions (e.g., EMB1006-YFP) and confocal microscopy, which has demonstrated co-localization with chlorophyll autofluorescence, confirming EMB1006's chloroplast localization .

What are the recommended controls when working with EMB1006 antibodies?

When using EMB1006 antibodies in experimental protocols, several controls are essential:

• Negative Controls:

  • Wild-type samples without tagged EMB1006

  • Samples expressing only the tag (e.g., Myc-only expressing plants)

  • Non-relevant proteins of similar size/structure

• Positive Controls:

  • Purified recombinant EMB1006 protein

  • Previously validated samples expressing EMB1006-tag fusions

• Specificity Controls:

  • Competitive binding assays with unlabeled antibodies

  • Analysis of EMB1006 knockdown or knockout lines to confirm signal reduction

In RNA immunoprecipitation experiments, negative controls like LHCB1, ACTIN2, and rpl2 transcripts have been successfully used to demonstrate the specificity of EMB1006 binding to target transcripts .

How does EMB1006 bind specifically to target RNA sequences and what techniques can verify this interaction?

EMB1006 binds specifically to the sequence UUACCAAACGU close to the 3' end of clpP1 exon 2 . This binding specificity can be investigated through several advanced techniques:

• RNA Electrophoretic Mobility Shift Assay (REMSA):

  • Purify MBP-fused EMB1006 from E. coli

  • Synthesize Cy5-labeled RNA probes (e.g., Cy5-clpP1-exon2: AAUUACCAAACGUAUAGCAUUCC)

  • Incubate protein and RNA in appropriate buffer (1 mM MgCl2, 10 mM HEPES, pH 7.3, 20 mM KCl, 5% glycerol, 0.1 μg tRNA, and 1 mM DTT)

  • Analyze binding through native polyacrylamide gel electrophoresis

  • Detect signals using fluorescence imaging

• Competition Assays:

  • To confirm binding specificity, perform competition assays with increasing concentrations of non-labeled probe

  • As negative control, use non-relevant RNA sequences (e.g., clpP1-intron2-Cold: UUUUUUAGAUUAAAAAAAAAUUCG)

• RNA Immunoprecipitation followed by quantitative PCR (RIP-qPCR):

  • Use transgenic plants expressing EMB1006-Myc

  • Immunoprecipitate RNA-protein complexes using anti-Myc antibodies

  • Extract bound RNA and analyze by qPCR

  • Compare enrichment against control immunoprecipitations

What protein-protein interactions does EMB1006 form and how can these be characterized?

EMB1006 interacts with both EMB1270 and CFM2, which themselves interact with each other, forming a protein complex that facilitates plastid intron splicing . These interactions can be characterized through:

• Yeast Two-Hybrid (Y2H):

  • Clone EMB1006 into bait vector and potential interacting proteins into prey vector

  • Transform into appropriate yeast strains

  • Test growth on selective media and quantify interaction strength

• Split Luciferase Complementation Assay:

  • Fuse EMB1006 to N-terminal fragment of luciferase

  • Fuse potential interacting proteins to C-terminal fragment

  • Co-express in plant cells or protoplasts

  • Measure reconstituted luciferase activity

• Semi-in vivo Pull-down Assays:

  • Express and purify recombinant MBP-EMB1006 from E. coli

  • Extract proteins from plants expressing tagged potential interactors (e.g., CFM2-Myc, EMB1270-Myc)

  • Incubate proteins together with appropriate antibodies (anti-Myc)

  • Add magnetic Protein A/G beads

  • Wash extensively and analyze precipitates via immunoblotting with anti-Myc and anti-MBP antibodies

How can I distinguish between direct and indirect effects of EMB1006 on plastid gene expression?

Distinguishing direct from indirect effects requires multiple complementary approaches:

• Direct Binding Analysis:

  • Perform REMSA with purified EMB1006 and candidate RNA targets

  • Use competition assays to confirm specificity

  • Employ RIP-qPCR to validate interactions in vivo

• Genetic Analysis:

  • Generate EMB1006 knockdown lines with varying expression levels

  • Perform detailed phenotypic analysis correlating EMB1006 levels with splicing defects

  • Create point mutations in the RNA binding domain to specifically disrupt RNA binding without affecting protein-protein interactions

• Temporal Analysis:

  • Use inducible silencing or expression systems

  • Monitor the sequence of molecular events following EMB1006 depletion

  • Early effects are more likely to be direct

• Comparative Analysis:

  Effect Type	Observation Time	Binding Evidence	Co-factor Requirement
  Direct	Immediate	Strong in vitro and in vivo binding	Independent of other factors
  Indirect	Delayed	Weak or no binding detected	Dependent on other factors

What is the optimal protocol for generating and validating EMB1006 antibodies?

While the search results don't provide a specific protocol for generating EMB1006 antibodies, a comprehensive approach would include:

• Antigen Selection and Preparation:

  • Choose unique, antigenic regions of EMB1006

  • Express and purify recombinant EMB1006 or synthesize peptides from unique regions

  • Verify protein quality before immunization

• Antibody Production:

  • Immunize animals (rabbits for polyclonal, mice for monoclonal)

  • Collect sera or hybridoma supernatants

  • Purify antibodies using affinity chromatography

• Validation Strategy:

  • Western blot against recombinant EMB1006

  • Immunoprecipitation of native EMB1006

  • Immunofluorescence in wild-type and EMB1006 knockdown plants

  • Cross-reactivity testing against related PPR proteins

• Alternative Approach:

  • Express tagged versions of EMB1006 (EMB1006-Myc or EMB1006-YFP)

  • Use commercial anti-tag antibodies for detection

  • This approach has been successfully used in research

How can I perform RNA immunoprecipitation to identify EMB1006 RNA targets?

RNA immunoprecipitation (RIP) has been successfully used to identify EMB1006 RNA targets . A detailed protocol includes:

• Sample Preparation:

  • Generate transgenic plants expressing EMB1006-Myc under native promoter

  • Verify expression by immunoblotting

  • Harvest appropriate tissue (ideally green tissue where EMB1006 is highly expressed)

• Cross-linking and Lysis:

  • Cross-link protein-RNA complexes using formaldehyde (optional)

  • Isolate chloroplasts and prepare lysate in appropriate buffer

  • Include RNase inhibitors and protease inhibitors

• Immunoprecipitation:

  • Incubate lysate with anti-Myc antibodies

  • Add Protein A/G magnetic beads

  • Wash extensively to remove non-specific binding

• RNA Extraction and Analysis:

  • Extract RNA from immunoprecipitates

  • Perform reverse transcription and qPCR for candidate targets

  • Include negative controls (non-targets like LHCB1, ACTIN2, rpl2)

  • Calculate enrichment compared to input and control IP

• Data Analysis:

  RNA Target	Fold Enrichment in EMB1006-Myc IP	Fold Enrichment in Control IP	Significance
  clpP1	High (>10-fold)	Low (<2-fold)	p<0.01
  rps12	High (>10-fold)	Low (<2-fold)	p<0.01
  ycf3	Moderate (5-10 fold)	Low (<2-fold)	p<0.05
  ndhA	Moderate (5-10 fold)	Low (<2-fold)	p<0.05
  LHCB1	Low (<2-fold)	Low (<2-fold)	Not significant

What are the key considerations for designing EMB1006 knockdown experiments?

When designing EMB1006 knockdown experiments, consider:

• Knockout vs. Knockdown Strategy:

  • Complete knockout leads to embryo lethality (emb1006-1)

  • Co-suppression or inducible RNAi approaches are more suitable for functional studies

• Vector Design:

  • For co-suppression: 35S promoter driving EMB1006 (35S:EMB1006-6M/Col-0)

  • For inducible knockdown: estrogen or dexamethasone-inducible systems

  • Include appropriate selection markers

• Phenotypic Analysis:

  • Monitor plant development and chlorosis phenotypes

  • Analyze chloroplast development using microscopy

  • Measure photosynthetic parameters

• Molecular Analysis:

  • Verify knockdown efficiency using RT-qPCR

  • Assess splicing defects in target introns (clpP1 intron 2, rps12 intron 2)

  • Analyze protein levels of affected plastid proteins (ClpP1, RPS2, etc.)

• Controls:

  • Wild-type plants

  • Plants expressing non-targeting constructs

  • Complementation lines expressing EMB1006-Myc to confirm specificity

How can I resolve inconsistent results in EMB1006 antibody detection experiments?

When facing inconsistent results in EMB1006 antibody experiments, consider these troubleshooting approaches:

• Protein Extraction Issues:

  • Ensure complete extraction of chloroplast proteins

  • Use appropriate detergents for membrane-associated proteins

  • Include protease inhibitors to prevent degradation

  • Maintain cold temperature throughout extraction

• Antibody Specificity Problems:

  • Validate antibody specificity using recombinant EMB1006

  • Perform preabsorption with purified antigen

  • Compare results from multiple antibodies (if available)

• Technical Optimization:

  • Adjust antibody concentration and incubation conditions

  • Optimize blocking conditions to reduce background

  • Try alternative detection systems (chemiluminescence vs. fluorescence)

• Experimental Design Issues:

  • Include positive and negative controls in every experiment

  • Use biological and technical replicates

  • Quantify signals using appropriate software and statistical analysis

How can I analyze complex data from EMB1006 functional studies to distinguish primary and secondary effects?

Analyzing complex data from EMB1006 functional studies requires:

• Temporal Analysis:

  • Use time-course experiments with inducible systems

  • Monitor changes in RNA splicing, protein levels, and phenotypes

  • Early changes are more likely to be primary effects

• Correlation Analysis:

  • Correlate EMB1006 expression levels with splicing efficiency

  • Use multiple knockdown lines with varying expression levels

  • Establish dose-response relationships

• Network Analysis:

  • Integrate data on RNA binding, protein interactions, and splicing defects

  • Construct pathway models distinguishing direct targets from downstream effects

  • Compare with other splicing factor mutants (EMB1270, CFM2)

• Statistical Approaches:

  Analysis Type	Application	Software Tools	Key Parameters
  Principal Component Analysis	Identify patterns in multi-dimensional data	R (prcomp), Python (sklearn)	Variance explained, component loadings
  Hierarchical Clustering	Group genes by expression patterns	R (hclust), Python (scipy)	Distance metric, linkage method
  Differential Expression	Identify significantly affected genes	DESeq2, edgeR	Fold change, adjusted p-value
  Pathway Enrichment	Identify affected biological processes	GSEA, g:Profiler	Enrichment score, FDR

What are the common pitfalls in interpreting RNA-protein interaction data for EMB1006?

When interpreting RNA-protein interaction data for EMB1006, be aware of these common pitfalls:

• Non-specific Binding:

  • RNA-binding proteins can show promiscuous binding in vitro

  • Always include competition assays with specific and non-specific competitors

  • Compare binding affinity (Kd) across multiple candidate targets

• Buffer Conditions:

  • Interaction strength can vary dramatically with salt concentration and pH

  • Test multiple buffer conditions that mimic physiological environments

  • Report binding conditions alongside results

• Fusion Tag Effects:

  • MBP or other fusion tags may affect binding properties

  • Compare results with different tag positions (N-terminal vs. C-terminal)

  • Ideally, validate with tag-free protein

• In Vitro vs. In Vivo Discrepancies:

  • Binding observed in vitro may not occur in vivo due to competition or cofactors

  • Always validate in vitro findings with in vivo methods like RIP-qPCR

  • Consider the native context (plastid environment, protein complexes)

• Data Integration:

  • Single experiments may miss the biological complexity

  • Integrate REMSA, RIP-qPCR, and functional studies

  • Consider the broader context of PPR protein function in plastid RNA metabolism