PPP1R11 Antibody

What is PPP1R11 and why is it significant in immunological research?

PPP1R11 (Protein Phosphatase 1 Regulatory Inhibitor Subunit 11) is a RING finger E3 ligase that plays a critical role in regulating Toll-like receptor 2 (TLR2) signaling. Its significance lies in its ability to directly ubiquitinate TLR2 both in vitro and in vivo, leading to TLR2 degradation and disruption of the signaling cascade . This mechanism is particularly important in the context of innate immunity and inflammatory responses to gram-positive bacterial infections, especially Staphylococcus aureus. The protein acts as a negative regulator of TLR2 signaling, creating a balance between necessary inflammatory responses for pathogen clearance and prevention of excessive inflammation that could cause tissue damage. Research into PPP1R11 provides crucial insights into innate immune regulation and potential therapeutic targets for infectious diseases.

What are the validated antibodies available for PPP1R11 detection?

Several validated antibodies have been developed for PPP1R11 detection in research applications. One well-documented PPP1R11 antibody was raised against the synthetic peptide sequence EPENQSLTMKLRKR and has been validated in previous studies, including work by Cheng et al. (2009) . This antibody is typically used at a 1:1,000 dilution for western blotting applications. Custom antibodies have also been developed by specialized companies such as Yenzym Antibodies, LLC . When selecting a PPP1R11 antibody, researchers should consider its validation history, epitope specificity, and performance in the intended experimental applications (western blotting, immunoprecipitation, or immunofluorescence).

How should PPP1R11 antibodies be validated for experimental use?

Proper validation of PPP1R11 antibodies should follow a multi-step approach to ensure specificity and reliability:

• Overexpression and knockdown controls: Test the antibody in cells with PPP1R11 overexpression and knockdown/knockout to confirm specific binding. The antibody should show increased signal with overexpression and decreased signal with knockdown.

• Western blot validation: Confirm the antibody detects a protein of the expected molecular weight (~36 kDa for PPP1R11).

• Immunoprecipitation assays: Validate the antibody's ability to specifically pull down PPP1R11 from cell lysates.

• Cross-reactivity testing: Ensure the antibody doesn't recognize related protein phosphatase regulatory subunits.

• Peptide competition assays: Pre-incubating the antibody with the immunizing peptide should abolish specific signals.

Researchers should document validation results and refer to previously validated antibodies, such as those used in publications like Cheng et al., 2009, as benchmarks for comparison .

How can PPP1R11 antibodies be optimized for co-immunoprecipitation studies with TLR2?

Optimizing PPP1R11 antibodies for co-immunoprecipitation (co-IP) studies with TLR2 requires careful consideration of several experimental parameters:

• Antibody orientation: The PPP1R11 antibody can be used either for immunoprecipitation or for detection in western blotting after TLR2 pull-down. Research has shown that the interaction between PPP1R11 and TLR2 is enhanced after treatment with TLR2 ligands like Pam3CSK4 for 4-6 hours .

• Buffer optimization: Use buffers containing 1% NP-40 or 0.5% Triton X-100 with protease inhibitors to preserve the interaction. For studies involving ubiquitination, include 1 mM ubiquitin aldehyde to inhibit deubiquitinating enzymes .

• Cross-linking consideration: For transient interactions, consider using membrane-permeable cross-linkers before lysis.

• Controls: Always include IgG controls and samples from cells with PPP1R11 knockdown to confirm specificity.

• Detection strategy: After immunoprecipitation with the PPP1R11 antibody, probe for TLR2 using validated TLR2 antibodies. As demonstrated in previous studies, the highest levels of PPP1R11/TLR2 association correlate with the greatest TLR2 protein loss .

This approach has successfully demonstrated that PPP1R11 associates with TLR2 in a time-dependent manner following Pam3CSK4 treatment, peaking at 4-6 hours, which coincides with maximal TLR2 degradation .

What are the key considerations for using PPP1R11 antibodies in immunofluorescence microscopy?

When using PPP1R11 antibodies for immunofluorescence microscopy, researchers should consider these critical factors:

• Fixation protocol: Use 4% paraformaldehyde for 20 minutes for optimal antigen preservation .

• Blocking and permeabilization: Block with 2% BSA and permeabilize with 0.1-0.5% Triton X-100 to reduce background while allowing antibody access to intracellular PPP1R11.

• Antibody dilution optimization: Typically, a 1:500 dilution of primary antibody is effective, but this should be empirically determined for each application .

• Appropriate controls: Include negative controls (primary antibody omission), positive controls (cells overexpressing tagged PPP1R11), and siRNA knockdown controls to validate specificity.

• Co-localization studies: For investigating PPP1R11 interaction with TLR2, counterstain with validated TLR2 antibodies and analyze co-localization using confocal microscopy at 60x magnification .

• Counterstaining: DAPI for nuclear visualization and phalloidin for F-actin counterstaining provide important cellular context .

• Signal amplification: For low-abundance targets, consider using signal amplification techniques such as tyramide signal amplification.

Using these approaches, researchers can effectively visualize the subcellular localization of PPP1R11 and its co-localization with TLR2 or other interacting proteins.

How can PPP1R11 antibodies be used to investigate the role of PPP1R11 in S. aureus infections?

PPP1R11 antibodies can be instrumental in studying the role of PPP1R11 in S. aureus infections through several methodological approaches:

• Patient sample analysis: As demonstrated in clinical studies, PPP1R11 antibodies can be used to analyze expression levels in white blood cell (WBC) pellets from S. aureus-infected patients compared to controls. This approach has revealed a significant negative correlation between PPP1R11 and TLR2 levels specifically in infected patients, not observed in controls .

• In vivo infection models: In mouse models of S. aureus pneumonia, PPP1R11 antibodies can be used to:

  • Confirm altered expression following infection

  • Validate successful lentiviral overexpression or knockdown

  • Monitor protein levels in various tissues (lung, spleen, liver)

• Correlation with inflammation markers: Examine the relationship between PPP1R11 levels (detected by antibodies) and inflammatory markers (cytokines, cell counts, protein concentrations) in bronchoalveolar lavage fluid .

• Bacterial clearance assessment: Combine PPP1R11 immunoblotting with bacterial load quantification to establish correlations between PPP1R11 expression and bacterial clearance across multiple tissues .

This approach has revealed that PPP1R11 acts as a negative regulator of lung inflammation, where higher PPP1R11 levels reduce inflammation but compromise bacterial clearance, leading to increased systemic bacteremia .

What are the common issues with PPP1R11 antibody specificity and how can they be addressed?

Researchers may encounter several specificity issues when working with PPP1R11 antibodies, which can be addressed through systematic troubleshooting:

• Cross-reactivity with related proteins: PPP1R11 belongs to a family of protein phosphatase regulators, including PPP1R2 and PPP1R7, which share structural similarities . To address this:

  • Use custom antibodies raised against unique epitopes (e.g., EPENQSLTMKLRKR for PPP1R11)

  • Perform peptide competition assays to confirm specificity

  • Include lysates from PPP1R11 knockout cells as negative controls

• Background signal in immunoblotting: To reduce non-specific binding:

  • Optimize blocking conditions (try 5% non-fat milk vs. BSA)

  • Increase washing stringency with higher salt concentrations

  • Use shorter primary antibody incubation times at 4°C

  • Consider using secondary antibodies specific to the host species IgG subclass

• Variability between antibody lots: To ensure consistency:

  • Test each new lot against a standard sample

  • Maintain detailed records of antibody performance

  • Consider creating a large stock of a well-performing lot for long-term projects

• Epitope masking in fixed tissues: If detecting PPP1R11 in tissue sections:

  • Test different antigen retrieval methods (heat vs. enzymatic)

  • Compare different fixation protocols (paraformaldehyde vs. methanol)

  • Evaluate fresh vs. frozen tissue performance

Validation strategies should always include positive and negative controls, and researchers should be particularly cautious when interpreting results from new antibody sources or lots.

How should researchers optimize PPP1R11 antibody concentrations for western blotting?

Optimizing PPP1R11 antibody concentrations for western blotting requires a systematic approach to achieve the best signal-to-noise ratio:

• Initial concentration testing: Begin with the manufacturer's recommended dilution, typically 1:1,000 for PPP1R11 antibodies , and test a range from 1:500 to 1:5,000.

• Sample loading optimization: For endogenous PPP1R11 detection, start with 30-50 μg of total protein per lane. Adjust based on expression levels in your experimental system.

• Titration experiment design:

  • Prepare multiple identical blots with the same samples

  • Incubate each blot with a different antibody concentration

  • Keep all other conditions consistent (blocking, washing, secondary antibody, development time)

  • Evaluate signal-to-noise ratio for each concentration

• Blocking optimization: Test different blocking agents (5% milk, 3-5% BSA) alongside antibody dilution tests, as these can significantly affect background.

• Incubation conditions: Compare overnight incubation at 4°C versus 1-2 hours at room temperature at different antibody concentrations.

• Secondary antibody matching: Pair the optimized primary antibody dilution with appropriate secondary antibody concentration (typically 1:5,000 to 1:20,000).

• Detection system considerations: For weakly expressed PPP1R11, consider using enhanced chemiluminescence (ECL) with longer exposure times or more sensitive detection systems.

The optimal antibody concentration allows detection of PPP1R11 at the expected molecular weight (~36 kDa) with minimal background and should be able to detect differences in expression levels under experimental conditions, such as following Pam3CSK4 treatment .

How can PPP1R11 antibodies be used to investigate ubiquitination of TLR2?

PPP1R11 antibodies can be strategically employed to investigate the ubiquitination of TLR2 through several sophisticated approaches:

• Sequential immunoprecipitation protocol:

  • First, immunoprecipitate TLR2 from cell lysates

  • Probe with anti-ubiquitin antibodies to detect ubiquitination status

  • Re-probe with PPP1R11 antibodies to confirm association

  • This approach has successfully demonstrated increased TLR2 ubiquitination in conjunction with increased PPP1R11 association following Pam3CSK4 treatment

• In vitro ubiquitination assays:

  • Set up reactions containing 50 mM Tris pH 7.5, 2.5 mM MgCl2, 0.6 mM DTT, 2 mM ATP

  • Add 1.5 ng/ml E1, appropriate E2 conjugating enzymes, and 1 mg/ml ubiquitin

  • Include 1 mM ubiquitin aldehyde to inhibit deubiquitinating enzymes

  • Add in vitro synthesized V5-tagged TLR2 and PPP1R11

  • Use PPP1R11 antibodies to confirm the presence of PPP1R11 in the reaction

  • After incubation, immunoblot for V5 to detect TLR2 ubiquitination

• Site-specific ubiquitination analysis:

  • Use PPP1R11 antibodies in combination with TLR2 mutants (e.g., K754R) to identify specific ubiquitination sites

  • Compare ubiquitination patterns between wild-type and mutant TLR2 in the presence of PPP1R11

• Temporal dynamics investigation:

  • Treat cells with Pam3CSK4 for various time points (1-6 hours)

  • At each time point, immunoprecipitate TLR2 and probe for ubiquitination and PPP1R11 association

  • This approach has revealed that TLR2 ubiquitination begins approximately 1 hour after Pam3CSK4 treatment, coinciding with increased PPP1R11/TLR2 association

This methodological approach has been instrumental in establishing PPP1R11 as an authentic E3 ligase for TLR2, demonstrating its role in mediating TLR2 degradation through the ubiquitin-proteasome pathway .

What approaches can be used to study the correlation between PPP1R11 and TLR2 expression in clinical samples?

Studying the correlation between PPP1R11 and TLR2 expression in clinical samples requires sophisticated methodological approaches:

• Sample collection and processing protocol:

  • Isolate white blood cell (WBC) pellets from patients with confirmed S. aureus infections and appropriate controls

  • Process samples consistently to minimize technical variability

  • Store samples with protease inhibitors to preserve protein integrity

• Patient stratification criteria:

  • Group patients based on infection status (S. aureus-positive vs. controls)

  • Consider additional clinical parameters (mechanical ventilation status, ARDS risk factors)

  • Document infection sites (tracheal aspirates, blood, or both)

• Quantitative immunoblotting protocol:

  • Extract proteins using standardized lysis buffers

  • Determine total protein concentration by BCA or Bradford assay

  • Load equal amounts of protein for electrophoresis

  • Transfer to PVDF or nitrocellulose membranes

  • Probe with validated antibodies for PPP1R11 and TLR2

  • Use appropriate loading controls (e.g., actin)

  • Perform densitometric analysis with calibration standards

• Correlation analysis methods:

  • Plot PPP1R11 vs. TLR2 expression levels

  • Calculate Pearson or Spearman correlation coefficients

  • Perform statistical significance testing

  • Conduct multivariate analysis to account for clinical covariates

• Validation with alternative techniques:

  • Confirm protein expression patterns with immunohistochemistry

  • Assess mRNA levels using qRT-PCR

  • Consider single-cell analysis to identify cell-specific expression patterns

This methodological approach has revealed a significant negative correlation between PPP1R11 and TLR2 levels specifically in S. aureus-infected patients, while no correlation was observed in control patients . This finding suggests that the PPP1R11/TLR2 regulatory pathway is specifically activated during S. aureus infection, providing valuable insights into the mechanisms of host response to bacterial pathogens.

How can CRISPR-Cas9 technology be combined with PPP1R11 antibodies for functional studies?

Combining CRISPR-Cas9 technology with PPP1R11 antibodies offers powerful approaches for functional characterization:

• CRISPR knockout validation protocol:

  • Design gRNAs targeting the first exon of PPP1R11 (e.g., TTGTAGGACGCCGTCCTTTG as used in previous studies)

  • Transfect cells with CRISPR-Cas9 components and select single-cell clones

  • Use PPP1R11 antibodies to confirm complete protein knockout by western blotting

  • Sequence-verify the genomic modification

• Rescue experiments methodology:

  • In PPP1R11 knockout cells, reintroduce wild-type or mutant PPP1R11

  • Use antibodies to confirm expression levels of the reintroduced protein

  • Compare phenotypic outcomes to establish structure-function relationships

• Endogenous tagging approach:

  • Use CRISPR-Cas9 to introduce epitope tags at the endogenous PPP1R11 locus

  • Validate tag insertion using genomic PCR and sequencing

  • Compare antibody detection of native vs. tagged PPP1R11 to assess antibody efficacy

• Functional readouts assessment:

  • In PPP1R11 knockout cells, measure TLR2 protein half-life

  • Assess TLR2-dependent cytokine release (IL-6, CXCL1) following PAM3CSK4 stimulation

  • Previous studies have demonstrated stabilized TLR2 half-life and increased cytokine release in PPP1R11 knockout cells

• Domain-specific mutagenesis:

  • Create CRISPR-engineered point mutations in functional domains of PPP1R11

  • Use antibodies to confirm expression of the mutant protein

  • Assess impact on TLR2 ubiquitination and degradation

This integrated approach has successfully demonstrated that PPP1R11 knockout significantly stabilizes TLR2 protein and enhances TLR2-linked inflammatory signaling, providing compelling evidence for the physiological role of PPP1R11 in regulating innate immune responses .

What are the considerations for developing phospho-specific PPP1R11 antibodies?

Developing phospho-specific PPP1R11 antibodies requires careful consideration of several technical aspects:

• Phosphorylation site identification strategy:

  • Conduct bioinformatic analysis to predict potential phosphorylation sites

  • Perform mass spectrometry analysis of PPP1R11 isolated from cells under different conditions

  • Consider sites that might regulate E3 ligase activity or substrate recognition

• Phospho-peptide design principles:

  • Select peptides of 10-15 amino acids with the phosphorylated residue centrally positioned

  • Ensure peptide sequence is unique to PPP1R11

  • Include a terminal cysteine for carrier protein conjugation if not naturally present

• Immunization and screening protocol:

  • Immunize rabbits with the phospho-peptide conjugated to KLH or BSA

  • Screen sera against both phosphorylated and non-phosphorylated peptides

  • Perform affinity purification using phospho-peptide columns

  • Conduct negative selection using non-phosphorylated peptide columns

• Validation requirements:

  • Test antibody specificity using phosphatase-treated samples

  • Validate with phosphomimetic (S/T→D/E) and phospho-deficient (S/T→A) mutants

  • Confirm phosphorylation-dependent recognition in cells treated with kinase activators/inhibitors

• Application-specific optimization:

  • For western blotting: include phosphatase inhibitors in lysis buffers

  • For immunoprecipitation: optimize buffer conditions to preserve phosphorylation

  • For immunofluorescence: evaluate different fixation methods for epitope preservation

While no phospho-specific PPP1R11 antibodies are described in the provided sources, development of such tools would be valuable for investigating potential regulatory mechanisms controlling PPP1R11's E3 ligase activity toward TLR2, as phosphorylation often regulates E3 ligase substrate targeting .

How do different fixation and permeabilization methods affect PPP1R11 antibody performance in immunofluorescence?

Different fixation and permeabilization methods can significantly impact PPP1R11 antibody performance in immunofluorescence. Below is a comparative analysis of common methods:

Table 1: Comparative Analysis of Fixation Methods for PPP1R11 Immunofluorescence

Table 2: Permeabilization Method Comparison for PPP1R11 Detection

Best Practices Based on Experimental Data:

• The standard protocol of 4% paraformaldehyde fixation for 20 minutes followed by 0.1-0.5% Triton X-100 permeabilization has been successfully used for detection of PPP1R11 in cultured cells .

• When co-staining for PPP1R11 and membrane-associated TLR2, a sequential approach may be beneficial:

  • Fix with 4% paraformaldehyde

  • Perform initial immunostaining for TLR2

  • Post-fix briefly (5 minutes with 2% PFA)

  • Permeabilize with 0.1% Triton X-100

  • Complete immunostaining for PPP1R11

• For optimal imaging results, counterstaining with DAPI for nuclei and phalloidin for F-actin provides important cellular context when interpreting PPP1R11 localization patterns, especially during infection studies .

These optimization strategies are essential for achieving specific and reproducible immunofluorescence results with PPP1R11 antibodies, particularly when investigating its dynamic association with TLR2 following stimulation with ligands such as Pam3CSK4.