PPP3R2 Antibody

Shipped with Ice Packs
In Stock

Description

Role in Male Fertility Studies

PPP3R2 regulates calcineurin activity in sperm motility. A 2021 clinical study compared PPP3R2 and PPP3CC (catalytic subunit) expression in asthenozoospermia (AZS):

ParameterPPP3CC (AZS vs. Normal)PPP3R2 (AZS vs. Normal)
mRNA Expression↓↓ (P < 0.05)No significant change
Protein Expression↓↓ (P < 0.05)No significant change
Correlation with Motilityr = 0.2592 (P < 0.05)No correlation

Key findings:

  • Calcineurin inhibitors (cyclosporine A, tacrolimus) reduced sperm motility, mimicking AZS .

  • PPP3CC protein levels directly correlated with progressive motility (PR), while PPP3R2 showed no association .

Immunohistochemistry (IHC) Validation

The antibody detects PPP3R2 in:

  • Human tissues: Testis, prostate cancer (optimal antigen retrieval: TE buffer pH 9.0) .

  • Mouse tissues: Testis (validated via IP and WB) .

Mechanism in Calcineurin Signaling

PPP3R2 binds calcineurin’s catalytic subunit (PPP3CC/PPP3CA) to modulate phosphatase activity. Calcineurin’s roles include:

  • NFAT dephosphorylation for immune activation .

  • Sperm motility regulation via calcium signaling .

  • Neuronal and cardiovascular function .

Published Studies Using 14005-1-AP

Study FocusKey FindingsApplication UsedCitation
miR-146a in OsteoarthritisPPP3R2 interacts with Camk2d to regulate cartilage homeostasisWB, IF (Publication 2)
Sperm MitochondriaSPATA33 localizes calcineurin to mitochondria, affecting motilityWB, IP (Publication 1)

Limitations and Considerations

  • Species Specificity: Limited to human and mouse; untested in other models .

  • Dilution Optimization: Requires titration for untested applications (e.g., ELISA) .

Product Specs

Buffer
PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. Store at -20°C. Avoid freeze/thaw cycles.
Lead Time
Typically, we can ship products within 1-3 business days of receiving your order. Delivery times may vary depending on the purchase method and location. Please consult your local distributor for specific delivery timeframes.
Synonyms
Calcineurin B like protein antibody; Calcineurin B type II (19kDa) antibody; Calcineurin B type II antibody; Calcineurin B-like protein antibody; Calcineurin BII antibody; Calcineurin subunit B isoform 2 antibody; Calcineurin subunit B type 2 antibody; CANB2_HUMAN antibody; CBLP antibody; CBLP like antibody; CNBII antibody; PPP3R1-like antibody; Ppp3r2 antibody; PPP3RL antibody; Protein phosphatase 2B regulatory subunit 2 antibody; Protein phosphatase 3 (formerly 2B) regulatory subunit B (19kD) beta isoform (calcineurin B type II) antibody; Protein phosphatase 3 (formerly 2B) regulatory subunit B beta isoform antibody; Protein phosphatase 3 (formerly 2B); regulatory subunit B; 19kDa; beta isoform (calcineurin B; type II) antibody; Protein phosphatase 3 regulatory subunit B (19kD) beta isoform (calcineurin B type II) antibody; Protein phosphatase 3 regulatory subunit B (calcineurin B) like antibody; Protein phosphatase 3 regulatory subunit B beta antibody; Protein phosphatase 3 regulatory subunit B beta isoform antibody
Target Names
Uniprot No.

Target Background

Function
PPP3R2 is the regulatory subunit of calcineurin, a calcium-dependent, calmodulin-stimulated protein phosphatase. It confers calcium sensitivity to the enzyme.
Gene References Into Functions
  • The PPP3RL gene is located on human chromosome 9q22. Transcripts of the PPP3RL gene are specifically expressed in the testis. PMID: 15865209
  • Cyclosporin and tacrolimus have significantly different effects on calcineurin activity in renal transplant patients with stable, well-functioning grafts. PMID: 16961774
  • Calcineurin B potentiates the activation of procaspase-3 by accelerating its proteolytic maturation. PMID: 17324936
  • Research suggests that Cabin1 possesses an additional CN binding domain within its 701-900 amino acid residues. PMID: 17531200
  • Data indicate that calcineurin might regulate the kinase activity of CDK4 in a cell cycle-dependent manner, potentially playing a crucial role in the negative regulation of CDK4. PMID: 17892862
Database Links

HGNC: 9318

OMIM: 613821

KEGG: hsa:5535

STRING: 9606.ENSP00000363939

UniGene: Hs.151167

Protein Families
Calcineurin regulatory subunit family
Tissue Specificity
Testis-specific.

Q&A

What is PPP3R2 and what is its biological significance?

PPP3R2 (Protein phosphatase 3 regulatory subunit B, beta isoform) is a regulatory subunit of calcineurin, a calcium-dependent, calmodulin-stimulated protein phosphatase heterodimer complex. PPP3R2 is also known as Calcineurin subunit B type 2, Calcineurin B-like protein (CBLP), or Calcineurin BII (CNBII) . The protein has a calculated molecular weight of approximately 19-20 kDa and is primarily expressed in testis tissue .

PPP3R2 functions by conferring calcium sensitivity to the calcineurin complex. In spermatozoa, PPP3R2 forms a testis-enriched calcineurin with PPP3CC (referred to as "sperm calcineurin") that is essential for sperm motility . Knockout studies have demonstrated that deletion of either Ppp3CC or Ppp3R2 results in male infertility with impaired sperm motility and a stiffened mid-piece , highlighting its critical role in reproductive biology.

What tissues show the highest expression of PPP3R2?

PPP3R2 exhibits a tissue-specific expression pattern with particularly high expression in:

  • Human testis tissue (strongly positive in IHC)

  • Mouse testis tissue (detected in WB and IP)

  • Rat testis tissue (detected in WB)

  • Human prostate cancer tissue (positive in IHC)

Lower expression levels have been noted in heart and kidney tissues . This tissue-specific expression pattern makes testis tissue an ideal positive control for antibody validation. When studying PPP3R2 expression, researchers should consider that expression may vary within testicular cell types, with particular enrichment in developing spermatozoa.

What are the typical applications for PPP3R2 antibodies?

PPP3R2 antibodies have been validated for multiple experimental applications:

ApplicationCommon DilutionsValidated SamplesConsiderations
Western Blot (WB)1:500-1:1000Mouse/rat/human testis19-20 kDa band expected
Immunoprecipitation (IP)0.5-4.0 μg for 1-3 mg lysateMouse testisEffective for protein interaction studies
Immunohistochemistry (IHC)1:50-1:500Human testis, prostate cancerAntigen retrieval with TE buffer pH 9.0 recommended
Immunofluorescence (IF)Varies by antibodyTestis tissue sectionsUsed for subcellular localization
ELISAVaries by antibodyPurified proteinFor quantitative detection

When selecting an application, researchers should consider the specific experimental question, available sample types, and whether qualitative or quantitative data is required .

How do I distinguish between PPP3R1 and PPP3R2 in experimental systems?

Distinguishing between these two calcineurin regulatory subunits requires careful experimental design:

  • Molecular weight differences: On Western blots, PPP3R1 typically appears at approximately 15 kDa, while PPP3R2 is observed at around 18-20 kDa .

  • Antibody selection: Use isoform-specific antibodies when possible. Some antibodies detect both proteins (like EPR24992-14) , while others are specific to PPP3R2 .

  • Tissue selection: PPP3R2 is primarily expressed in testis, while PPP3R1 has broader expression. Heart and kidney tissues express primarily PPP3R1 with minimal PPP3R2 .

  • Knockout controls: When available, samples from PPP3R2 knockout animals provide excellent negative controls to confirm antibody specificity.

  • Loading controls: Due to the similar molecular weights, ensure adequate gel resolution when attempting to distinguish these proteins on the same blot.

How can researchers optimize Western blot protocols for PPP3R2 detection?

Optimizing Western blot protocols for PPP3R2 requires attention to several key factors:

  • Sample preparation:

    • Use fresh testis tissue when possible

    • Include protease inhibitors in lysis buffers

    • Load 20-40 μg of total protein for tissue lysates

  • Gel electrophoresis:

    • Use 12-15% polyacrylamide gels for optimal resolution of the 19-20 kDa protein

    • Include molecular weight markers that clearly distinguish 15-20 kDa range

  • Transfer and blocking:

    • 5% non-fat dry milk in TBST has been successfully used for blocking

    • PVDF membranes are recommended for optimal protein binding

  • Antibody incubation:

    • Primary antibody dilutions of 1:500-1:2000 are typically effective

    • Overnight incubation at 4°C often yields better results than shorter incubations

  • Detection:

    • For low abundance samples, high-sensitivity ECL substrates may be necessary

    • Exposure times of 70-136 seconds have been reported for testis samples

When troubleshooting, compare results with positive control lysates from cells transfected with PPP3R2 or testis tissue known to express high levels of the protein.

What are the critical considerations for validating PPP3R2 antibody specificity?

Antibody validation is essential for reliable research outcomes. For PPP3R2 antibodies:

  • Positive controls:

    • Human, mouse, or rat testis tissue lysates

    • Lysates from cells transfected with PPP3R2 expression constructs

  • Negative controls:

    • Tissues with low/no expression (kidney has been used)

    • Untransfected cell lines for comparison with transfected samples

    • Isotype control antibodies for IP experiments

  • Validation across applications:

    • Cross-validate findings using multiple techniques (WB, IHC, IF)

    • Ensure consistent molecular weight detection across applications

  • Secondary antibody controls:

    • Include secondary antibody-only controls to detect non-specific binding

    • Use appropriate HRP-conjugated secondary antibodies (typically 1:2000-1:20000 dilution)

  • Blocking peptide competition:

    • When available, pre-incubation with immunizing peptide should reduce specific signal

Publication records can also provide confidence in antibody specificity. For example, some PPP3R2 antibodies have been cited in multiple peer-reviewed publications .

How does the interaction between PPP3R2 and PPP3CC impact sperm function, and how can this be studied?

The PPP3R2-PPP3CC interaction forms the sperm-specific calcineurin complex that is critical for sperm motility:

  • Functional significance:

    • Knockout of either Ppp3CC or Ppp3R2 results in male infertility

    • Sperm from knockout mice show impaired motility with a stiffened mid-piece

    • Calcineurin inhibitors (CsA and FK506) damage sperm motility in mice and rats

  • Experimental approaches to study this interaction:

    • Co-immunoprecipitation of PPP3R2 and PPP3CC from testis lysates

    • Immunofluorescence co-localization in sperm cells

    • Expression of tagged constructs in heterologous systems (e.g., HEK293T cells)

    • Correlation of protein levels with sperm progressive motility (PR)

  • Key interaction partners:

    • SPATA33 has been identified as an interactor with the PPP3R2-PPP3CC complex via a conserved PQIIIT motif

    • Mutations in this motif (PQIIIT to AQIIIT, PQAIIT, or PQIIAT) disrupt the interaction

  • Subcellular localization:

    • The complex localizes to sperm mitochondria, suggesting a role in energy production

    • This can be studied using subcellular fractionation and immunofluorescence

These interactions provide important mechanistic insights into male fertility and potential therapeutic targets for infertility treatments.

What methodological approaches can address contradictory findings in PPP3R2 expression studies?

Researchers occasionally encounter contradictory results when studying PPP3R2 expression. Several methodological approaches can help resolve these discrepancies:

  • Multi-method validation:

    • Compare protein expression (Western blot) with mRNA levels (qPCR)

    • Note that mRNA and protein levels may not always correlate, as observed in some studies

    • Use multiple antibodies targeting different epitopes when possible

  • Quantitative analysis:

    • Normalize protein levels to appropriate loading controls (GAPDH, β-actin)

    • Use densitometric analysis of Western blots for semi-quantitative comparisons

    • Include biological and technical replicates to account for sample variability

  • Sample preparation considerations:

    • Standardize tissue collection and processing protocols

    • Control for variables like age, species, and strain

    • Document post-mortem interval for human samples

  • Statistical approaches:

    • Perform correlation analyses between protein levels and functional parameters (e.g., sperm motility)

    • Use appropriate statistical tests based on sample size and distribution

    • Consider potential confounding variables in analysis

  • Technical troubleshooting:

    • For discrepant Western blot results, examine antibody lot-to-lot variation

    • Test different antigen retrieval methods for IHC/IF (TE buffer pH 9.0 vs. citrate buffer pH 6.0)

    • Evaluate sample degradation as a source of inconsistent results

How can researchers effectively study PPP3R2 in relation to male infertility?

Investigating the role of PPP3R2 in male infertility requires specialized approaches:

  • Clinical sample analysis:

    • Compare PPP3R2 expression in sperm from fertile versus infertile males

    • Specifically examine asthenozoospermic (AZS) samples versus normal sperm (NS)

    • Correlate PPP3R2 protein levels with progressive motility (PR) parameters

  • Functional assays:

    • Analyze sperm motility parameters in relation to PPP3R2 expression

    • Examine the effects of calcineurin inhibitors on sperm function

    • Use computer-assisted sperm analysis (CASA) for objective motility assessment

  • Molecular interaction studies:

    • Investigate PPP3R2-PPP3CC complex formation in infertile samples

    • Examine interactions with SPATA33 via the PQIIIT motif

    • Screen for mutations in PPP3R2 in infertility cases

  • Animal models:

    • Utilize Ppp3r2 knockout mice as models of infertility

    • Study the effects of conditional or tissue-specific knockdown

    • Evaluate potential rescue of fertility phenotypes

  • Therapeutic implications:

    • Test compounds that modulate calcineurin activity

    • Evaluate the effects of calcium signaling modulators on PPP3R2 function

    • Consider PPP3R2 as a potential biomarker for specific forms of male infertility

One study found that PPP3CC mRNA levels, but not PPP3R2 mRNA levels, were significantly different in AZS compared with NS, suggesting differential regulation of these calcineurin components in infertility .

What are the optimal storage and handling conditions for PPP3R2 antibodies?

Proper storage and handling are critical for maintaining antibody functionality:

  • Long-term storage:

    • Store at -20°C for one year or as recommended by manufacturer

    • Most PPP3R2 antibodies are supplied in a buffer containing 0.02% sodium azide and 50% glycerol at pH 7.3

  • Short-term storage:

    • For frequent use, store at 4°C for up to one month

    • Avoid repeated freeze-thaw cycles that can degrade antibody quality

  • Aliquoting recommendations:

    • For some formulations, aliquoting is unnecessary for -20°C storage

    • For others, creating small aliquots minimizes freeze-thaw damage

  • Shipping and temporary handling:

    • Antibodies are typically shipped on ice or with cold packs

    • Allow antibodies to equilibrate to room temperature before opening to prevent condensation

  • Working dilutions:

    • Prepare working dilutions fresh before use

    • Store diluted antibody at 4°C and use within 24-48 hours for optimal results

Always consult the manufacturer's specific recommendations, as formulations may vary between suppliers.

What are the optimal fixation and antigen retrieval methods for PPP3R2 immunohistochemistry?

Successful IHC detection of PPP3R2 depends on proper fixation and antigen retrieval:

  • Fixation protocols:

    • Formalin-fixed, paraffin-embedded (FFPE) tissues have been successfully used

    • 10% neutral-buffered formalin is typically recommended

    • Fixation time should be optimized (typically 24-48 hours)

  • Antigen retrieval methods:

    • Heat-mediated antigen retrieval with Tris-EDTA buffer (pH 9.0) for 20 minutes has shown good results

    • Citrate buffer (pH 6.0) can serve as an alternative

    • Microwave, pressure cooker, or dedicated antigen retrieval systems can be used

  • Antibody incubation parameters:

    • Dilutions of 1:50-1:500 are typically effective for IHC

    • Some protocols use very dilute antibody (1:10000, 0.052 μg/ml) with specific detection systems

    • Incubation for 30 minutes at room temperature has been successful

  • Detection systems:

    • Polymer-based detection systems (e.g., LeicaDS9800 Bond Polymer Refine Detection) provide sensitive results

    • Counterstaining with hematoxylin provides good nuclear contrast

  • Controls:

    • Positive control: human or mouse testis tissue

    • Negative control: kidney tissue (minimal expression)

    • Secondary antibody-only controls to assess non-specific binding

These parameters should be optimized for each specific antibody and tissue preparation method.

How can researchers effectively use PPP3R2 antibodies for co-immunoprecipitation studies?

Co-immunoprecipitation is valuable for studying PPP3R2 protein interactions:

  • Sample preparation:

    • Mouse testis tissue has been successfully used for IP of PPP3R2

    • Use 1.0-3.0 mg of total protein lysate for optimal results

    • Include protease and phosphatase inhibitors in lysis buffers

  • Antibody amounts:

    • 0.5-4.0 μg of antibody is typically recommended for IP

    • Antibody:protein ratio should be optimized for each experiment

  • IP protocol optimization:

    • Pre-clear lysates with protein A/G beads to reduce non-specific binding

    • Include appropriate negative controls (isotype control antibodies)

    • For reciprocal co-IP, confirm interactions by pulling down with antibodies against both interaction partners

  • Detection considerations:

    • Use specialized secondary antibodies for IP-Western blot detection (e.g., VeriBlot for IP Detection Reagent)

    • These minimize detection of IP antibody heavy and light chains

  • Experimental applications:

    • Study interaction between PPP3R2 and PPP3CC in testis lysates

    • Investigate binding partners like SPATA33 through the PQIIIT motif

    • Compare interaction patterns in normal versus infertile samples

When expressing tagged constructs in heterologous systems like HEK293T cells, tag placement should be carefully considered to avoid interfering with protein interactions .

What are emerging applications of PPP3R2 antibodies in reproductive medicine research?

PPP3R2 antibodies are enabling new research directions in reproductive biology:

  • Biomarker development:

    • Potential use of PPP3R2 as a diagnostic marker for specific forms of male infertility

    • Correlation between PPP3R2 expression and sperm functional parameters

  • Drug development applications:

    • Screening compounds that modulate PPP3R2-PPP3CC interaction

    • Evaluation of targeted approaches to enhance sperm motility

    • Understanding mechanisms of existing drugs affecting sperm function

  • Comparative species studies:

    • PPP3R2 antibodies react with human, mouse, and rat samples

    • Conservation of the PPP3R2-SPATA33 interaction across mammals

    • Evolutionary analysis of calcineurin signaling in reproduction

  • Integration with advanced techniques:

    • Combination with CRISPR/Cas9 to study PPP3R2 function

    • Single-cell analysis of PPP3R2 expression in testicular cell populations

    • Proteomic profiling of PPP3R2 interactomes in normal and pathological states

These emerging applications highlight the continuing importance of high-quality PPP3R2 antibodies in advancing our understanding of reproductive biology and pathophysiology.

How can apparent contradictions between PPP3R2 mRNA and protein levels be reconciled?

Researchers have observed discrepancies between mRNA and protein expression levels for PPP3R2, presenting interesting challenges:

  • Biological explanations:

    • Post-transcriptional regulation may affect the relationship between mRNA and protein levels

    • mRNA in mature sperm may represent historical gene expression from spermatogenesis rather than active translation

    • Protein stability and half-life considerations may lead to accumulation independent of mRNA levels

  • Methodological approaches:

    • Use matched samples for mRNA and protein analysis when possible

    • Employ absolute quantification methods for both mRNA (digital PCR) and protein (targeted mass spectrometry)

    • Correlation analysis between mRNA and protein levels across multiple samples

  • Technical considerations:

    • Ensure primer specificity for qPCR (see table below for validated primers)

    • Normalize to appropriate reference genes and proteins

    • Consider the sensitivity differences between detection methods

GeneProduct lengthPrimers (5'→3')Tm (°C)
PPP3R2106F: TTGCGTTCAGCATTTACGACAT
R: AGCTGCCAGTCCGTCAGGTT
60
  • Alternative approaches:

    • Study translation efficiency using polysome profiling

    • Investigate RNA-binding proteins that might regulate PPP3R2 translation

    • Examine potential microRNA regulation of PPP3R2 expression

Understanding these discrepancies may provide insights into the complex regulation of PPP3R2 during spermatogenesis and sperm function.

Quick Inquiry

Personal Email Detected
Please use an institutional or corporate email address for inquiries. Personal email accounts ( such as Gmail, Yahoo, and Outlook) are not accepted. *
© Copyright 2025 TheBiotek. All Rights Reserved.