PRCP Human

What is Prolyl Carboxypeptidase (PRCP) and what is its primary function in humans?

PRCP is a serine protease that cleaves C-terminal amino acids that are adjacent to proline residues in various peptides. Its principal function involves the processing of peptide hormones, particularly in the metabolism of angiotensin II to angiotensin-(1-7). While angiotensin-converting enzyme 2 (ACE2) is the primary enzyme responsible for this conversion at physiological pH, PRCP serves as an alternative pathway for processing these peptides, especially in acidic environments (pH <6) . This enzymatic activity is critical for regulating blood pressure, fluid balance, and kidney function through the renin-angiotensin system. PRCP also participates in other essential physiological processes through its proteolytic activities, including inflammation and glucose metabolism.

How does PRCP structure relate to its enzymatic function?

PRCP contains a catalytic triad typical of serine proteases, with serine-179 and histidine-455 being critical components . These amino acid residues form the active site responsible for the enzyme's proteolytic activity. When either of these residues is mutated to alanine (S179A or H455A), the catalytic activity of PRCP is abolished, creating an "enzyme-dead" variant that can be useful in experimental studies to distinguish between enzymatic and non-enzymatic functions of the protein . The structure of PRCP is optimized for recognizing substrates with proline in the penultimate position, allowing for specific peptide processing activities in various tissues including the kidney, pancreas, and vascular system.

What physiological conditions affect PRCP enzyme activity?

PRCP enzyme activity is significantly influenced by pH conditions, with distinct activity profiles observed at different pH levels. Research demonstrates that PRCP exhibits optimal activity in acidic environments (pH <6), where it can efficiently process angiotensin II to angiotensin-(1-7) even in the absence of ACE2 . At more neutral or alkaline conditions (pH ≥6), PRCP activity is reduced, and ACE2 becomes the dominant enzyme for this conversion. This pH-dependency suggests that PRCP may play crucial roles in microenvironments with acidic conditions, such as inflamed tissues, cancer microenvironments, or specific subcellular compartments. Additionally, substrate concentration impacts PRCP activity patterns, with differential processing observed at varying substrate levels .

What are the optimal assay conditions for measuring human PRCP activity in vitro?

The optimal conditions for measuring human PRCP activity in vitro involve a carefully controlled assay environment. Based on recombinant human PRCP protein protocols, the following methodology is recommended:

• Prepare rhPRCP at a concentration of 0.2 μg/mL in an appropriate assay buffer

• Prepare substrate (typically Z-Gly-Pro-AMC or similar fluorogenic substrates) at 400 μM in the same buffer

• Mix equal volumes (125 μL each) of diluted rhPRCP and substrate to achieve final concentrations of 0.1 μg/mL enzyme and 200 μM substrate

• Include appropriate controls, such as heat-inactivated enzyme (5 minutes at 100°C)

• Incubate the reaction mixture for 30 minutes at 37°C

• Stop the reaction by adding 250 μL of a solution containing 15 mM o-PA in 0.2 M NaOH with 0.1% (v/v) 2-Mercaptoethanol

• After a 10-minute room temperature incubation, load 200 μL of samples in duplicate into microplate wells

• Measure fluorescence at excitation/emission wavelengths of 330/450 nm using a top-read mode

This protocol provides a reliable methodology for quantifying PRCP enzymatic activity and can be adapted for inhibitor screening or comparative enzymatic studies.

How can researchers effectively distinguish between PRCP and ACE2 activities in renal angiotensin processing?

Distinguishing between PRCP and ACE2 activities in renal angiotensin processing requires a multi-faceted approach:

• pH-dependent assays: Perform parallel experiments at pH ≥6 and pH <6. At higher pH, ANG-(1-7) formation is significantly reduced in ACE2 knockout models, while at lower pH, formation of ANG-(1-7) in ACE2 KO mice is similar to wild-type mice, indicating PRCP activity .

• Genetic models: Utilize ACE2 knockout mouse models to isolate PRCP-dependent activities. In tissue samples from these models, any conversion of angiotensin II to angiotensin-(1-7) can be attributed to alternative enzymes, primarily PRCP .

• Mass spectrometry characterization: Apply in situ and in vitro mass spectrometric techniques to monitor substrate processing. This allows precise identification of the peptide products and can distinguish between different enzymatic pathways .

• Specific inhibitors: Apply selective inhibitors such as Z-Pro-Prolinal (ZPP) that target prolyl peptidases including PRCP but not ACE2, and compare with ACE2-specific inhibitors .

• Combined in vitro and in vivo approaches: Cross-validate findings using both purified enzymes in controlled conditions and tissue-specific expression systems to account for the complex biological context .

The combination of these approaches allows researchers to differentiate between the contributions of these two enzymes to angiotensin processing in renal and other tissues.

What mutagenesis approaches are most effective for studying PRCP structure-function relationships?

Site-directed mutagenesis of the catalytic triad represents the most effective approach for studying PRCP structure-function relationships. Based on research literature, the following methodological approach is recommended:

• Target the catalytic triad: Focus mutations on serine-179 and histidine-455, which are essential components of PRCP's catalytic mechanism. Substitution of these residues with alanine (S179A and H455A) effectively eliminates enzymatic activity while preserving protein structure .

• Primer design: Design primers that incorporate the desired nucleotide changes. For S179A, primers such as ATTGCCATAGGAGGCGCCTATGGTGGCATGC and GCATGCCACCATAGGCGCCTCCTATGGCAAT can be used. For H455A, primers like CGGAGATCTAAGTGGGCGGCCCCCTCTGAGAT and ATCTCAGAGGGGGCCGCCCACTTAGATCTCCG are effective .

• PCR-based mutagenesis: Utilize the QuickChange Site-directed Mutagenesis kit or similar technologies for introducing point mutations in a controlled manner .

• Expression system: For transient expression studies, transfection of cultured cells (e.g., Panc-1 cells) with 5 μg of plasmid DNA using Lipofectamine 3000 Reagent or equivalent transfection methods works efficiently. Allow 72 hours after transfection before harvesting cells for analysis .

• Functional validation: Confirm the impact of mutations through activity assays, comparing wild-type and mutant PRCP under identical conditions.

This systematic mutagenesis approach allows researchers to precisely determine how specific amino acid residues contribute to PRCP enzymatic function, substrate specificity, and interactions with regulatory molecules or inhibitors.

How does PRCP contribute to cancer cell survival and proliferation?

PRCP, along with its related family member prolylendopeptidase (PREP), has been identified as essential for proliferation and survival of cancer cells, particularly in pancreatic cancer. The molecular mechanisms involve several interconnected pathways:

• IRS-1 stability regulation: PRCP and PREP play critical roles in maintaining insulin receptor substrate-1 (IRS-1) stability, which is essential for cancer cell proliferation and survival signaling. Depletion of PRCP and PREP reduces IRS-1 levels and associated signaling .

• PI3K-AKT pathway modulation: Research demonstrates that in cancer cells, PRCP/PREP knockdown or inhibition reduces both basal and rapamycin-induced activation of phosphoinositide 3-kinase (PI3K). This affects downstream phosphorylation of AKT, a key survival kinase .

• Rapamycin resistance counteraction: Cancer cells often develop resistance to mTOR inhibitors like rapamycin through feedback activation of AKT. PRCP/PREP depletion blocks this compensatory activation, as demonstrated in experiments where PRCP/PREP knockdown significantly lowered both basal and rapamycin-induced PI3K activity compared to control cells .

• Enhanced therapeutic efficacy: The combination of prolyl peptidase inhibition (using compounds such as Z-Pro-Prolinal) with rapamycin shows increased cytotoxicity in pancreatic cancer cell lines (Panc-1, PK9, and Capan-1), suggesting a potential therapeutic strategy .

These findings highlight PRCP's role in cancer biology beyond its enzymatic function in peptide processing, positioning it as a potential therapeutic target for cancers that leverage PI3K-AKT signaling for survival.

What is the experimental evidence for PRCP's role in renal angiotensin processing independent of ACE2?

The experimental evidence for PRCP's role as an alternative enzyme for renal angiotensin processing independent of ACE2 comes from several complementary approaches:

• Genetic knockout models: Studies utilizing ACE2 knockout (KO) mice demonstrated that at pH <6, formation of angiotensin-(1-7) from angiotensin II was similar between ACE2 KO mice and wild-type mice, indicating the presence of ACE2-independent pathways .

• pH-dependent processing analysis: Mass spectrometric characterization revealed that substrate processing patterns change with pH conditions. At pH ≥6, ANG-(1-7) formation was significantly reduced in ACE2 KO mice, but at pH <6, this difference disappeared, suggesting alternative peptidases (primarily PRCP) can effectively process angiotensin II in acidic conditions .

• In situ and in vitro validation: Both in tissue samples and in controlled enzyme reactions, PRCP demonstrated the ability to convert angiotensin II to angiotensin-(1-7) in the absence of ACE2, particularly under acidic conditions .

• Substrate concentration effects: Research showed that the processing of angiotensin II varies with substrate concentration, with different enzyme affinities becoming apparent at various concentration ranges, further supporting the complementary roles of ACE2 and PRCP .

This evidence collectively establishes PRCP as a physiologically relevant alternative pathway for angiotensin II processing, particularly in microenvironments where pH is lower than physiological levels or in conditions where ACE2 activity is compromised.

How do PRCP inhibitors affect the PI3K/AKT signaling pathway in disease models?

PRCP inhibitors exert significant effects on the PI3K/AKT signaling pathway, which has important implications for disease treatment, particularly in cancer. The experimental evidence reveals:

• Suppression of feedback activation: PRCP inhibition with Z-Pro-Prolinal (ZPP) prevents the compensatory activation of AKT that typically occurs in response to mTOR inhibition with rapamycin. This effect is mediated through reduced IRS-1 levels and diminished PI3K activity .

• Reduced PI3K activity: In cells treated with PRCP inhibitors, both basal and rapamycin-induced PI3K activity are significantly reduced. This was demonstrated through in vitro kinase activity assays of immunoprecipitated IRS-1 and p85 (the PI3K active subunit) .

• Synergistic cytotoxicity: The combination of PRCP inhibition and mTOR inhibition shows enhanced cytotoxicity in cancer cell models compared to either treatment alone. MTT viability assays demonstrated that rapamycin caused a dose-dependent reduction in viability, which was enhanced by co-treatment with ZPP in multiple pancreatic cancer cell lines (Panc-1, PK9, and Capan-1) .

• Mechanism of action: PRCP inhibitors appear to interfere with the stability of IRS-1, a critical adaptor protein for insulin and IGF-1 receptor signaling. By reducing IRS-1 levels, PRCP inhibition prevents the assembly of active signaling complexes that would otherwise compensate for mTOR inhibition .

This mechanistic understanding suggests that PRCP inhibitors could be valuable therapeutic tools for enhancing the efficacy of existing targeted therapies, particularly in diseases where the PI3K/AKT pathway drives resistance mechanisms.

How do substrate concentration and pH affect PRCP enzymatic activity?

Substrate concentration and pH are critical factors that influence PRCP enzymatic activity, with significant implications for its physiological roles and experimental analysis:

The experimental evidence from mass spectrometric characterization studies demonstrates that:

• pH dependency: PRCP shows enhanced activity in acidic conditions (pH <6), where it effectively processes angiotensin II to angiotensin-(1-7) even in ACE2 knockout models. At more neutral or basic pH (≥6), ACE2 is the predominant enzyme for this conversion .

• Substrate concentration effects: The efficiency of PRCP-mediated peptide processing increases with substrate concentration. This characteristic influences its relative contribution to peptide metabolism in different physiological contexts .

• Tissue-specific variations: The impact of pH and substrate concentration on PRCP activity varies between tissues, with renal tissue showing particularly distinct patterns of pH-dependent processing .

These findings have important implications for experimental design when studying PRCP function, as well as for understanding its physiological roles in microenvironments with varying pH conditions, such as inflammatory sites, tumor microenvironments, or specialized cellular compartments.

What protein-protein interactions are critical for PRCP's cellular functions?

PRCP engages in several key protein-protein interactions that are essential for its diverse cellular functions:

• IRS-1 interaction: PRCP and its related family member PREP interact with insulin receptor substrate-1 (IRS-1), a critical adaptor protein in insulin and IGF-1 signaling. This interaction appears to stabilize IRS-1, protecting it from degradation. Depletion of PRCP and PREP leads to reduced IRS-1 levels, suggesting a direct or indirect stabilizing interaction .

• PI3K regulatory subunit (p85) association: Research demonstrates that PRCP influences the formation or stability of IRS-1-p85 complexes, which are essential for PI3K activation. Immunoprecipitation studies show that PRCP/PREP depletion reduces both IRS-1- and p85-associated PI3K activity .

• mTOR pathway components: PRCP interacts with components of the mTOR signaling pathway, as evidenced by its ability to influence rapamycin-induced feedback activation of AKT. This suggests functional interactions with mTORC1, S6K, or other intermediaries in this signaling cascade .

• Angiotensin peptides binding: As a peptidase, PRCP directly binds angiotensin peptides, particularly angiotensin II, as substrates. This binding is influenced by pH conditions and appears to have different characteristics compared to ACE2-angiotensin II binding .

These protein-protein interactions extend PRCP's functions beyond simple enzymatic activity, positioning it as a multifunctional protein involved in diverse cellular processes including metabolism, cell survival, and peptide hormone processing.

How does PRCP coordinate with other prolyl peptidases in metabolic pathways?

PRCP coordinates with other prolyl peptidases, particularly PREP (prolylendopeptidase), in complex metabolic networks that impact cellular signaling, peptide processing, and disease progression:

• Functional redundancy and complementarity: PRCP and PREP show overlapping functions in maintaining IRS-1 stability and PI3K signaling. Research demonstrates that simultaneous depletion of both enzymes has a more profound effect on these pathways than individual knockdown, suggesting partial functional redundancy .

• Differential substrate specificity: While both process substrates with proline residues, PRCP preferentially cleaves C-terminal amino acids adjacent to proline (carboxypeptidase activity), while PREP cleaves internal peptide bonds at the C-terminal side of proline residues (endopeptidase activity). This distinction allows coordinated processing of different regions of the same peptide substrates .

• Shared inhibitor sensitivity: Both enzymes are inhibited by compounds like Z-Pro-Prolinal (ZPP), suggesting similar active site structures despite different substrate preferences. This shared pharmacological profile allows for simultaneous targeting in experimental and potential therapeutic applications .

• Compensatory regulation: When ACE2 activity is reduced or absent, PRCP activity becomes more significant in angiotensin processing pathways, particularly in acidic conditions. This compensatory relationship ensures continued peptide processing in various physiological contexts .

• Synergistic effects in disease contexts: In cancer cells, PRCP and PREP appear to work together to promote cell survival and proliferation through their effects on signaling pathways. Targeting both enzymes simultaneously shows enhanced therapeutic potential compared to single enzyme inhibition .

This coordination between prolyl peptidases creates a sophisticated network for peptide metabolism regulation, with significant implications for both normal physiology and disease intervention strategies.

What are the emerging therapeutic applications targeting PRCP in human diseases?

Emerging therapeutic applications targeting PRCP in human diseases span several clinical areas with significant potential:

• Cancer therapy enhancement: Research has identified PRCP as a potential target for improving cancer treatment efficacy, particularly in combination with mTOR inhibitors like rapamycin. By preventing the compensatory activation of PI3K/AKT that typically limits mTOR inhibitor effectiveness, PRCP inhibition may overcome treatment resistance. Studies in pancreatic cancer cell lines (Panc-1, PK9, and Capan-1) demonstrate enhanced cytotoxicity when PRCP inhibition is combined with rapamycin .

• Renal and cardiovascular disease management: Given PRCP's role in alternative angiotensin II processing, particularly in acidic conditions, targeting this enzyme offers a novel approach to modulating the renin-angiotensin system. This could be particularly valuable in contexts where ACE2 function is compromised or in specific tissue microenvironments .

• Inflammatory condition treatment: The pH-dependent activity of PRCP suggests it may play specialized roles in inflammatory microenvironments, which typically feature lower pH. Targeted modulation of PRCP activity in these contexts could provide new approaches to managing inflammatory conditions .

• Metabolic disorder interventions: PRCP's involvement in IRS-1 stability and PI3K signaling suggests potential applications in metabolic disorders, particularly those involving insulin resistance or aberrant growth factor signaling. Modulating PRCP activity could offer new avenues for addressing these conditions .

The development of specific PRCP inhibitors with improved pharmacokinetic properties and tissue selectivity represents a key focus for translating these findings into clinical applications. Current research suggests that dual targeting of PRCP and related prolyl peptidases like PREP may offer superior therapeutic outcomes in certain disease contexts.

How do recent mass spectrometry advances improve PRCP activity characterization?

Recent advances in mass spectrometry have revolutionized PRCP activity characterization, enabling more precise and comprehensive analysis of this enzyme's functions:

• In situ peptide processing analysis: Modern mass spectrometric approaches allow researchers to monitor peptide processing directly in tissue samples, providing insights into PRCP activity within the complex cellular environment. This in situ characterization reveals physiologically relevant activity patterns that may not be apparent in simplified in vitro systems .

• pH-dependent activity profiling: Mass spectrometry enables detailed characterization of how PRCP activity changes across pH gradients, revealing distinct activity profiles at different pH levels. This has been crucial for identifying PRCP as an alternative enzyme for angiotensin II processing in acidic conditions .

• Comparative enzyme contribution assessment: In studies using genetic knockout models, mass spectrometry can precisely quantify the relative contributions of different enzymes (such as PRCP versus ACE2) to specific peptide processing pathways under various conditions .

• Substrate specificity determination: Advanced mass spectrometric techniques allow for comprehensive mapping of PRCP substrate preferences beyond known targets, expanding our understanding of this enzyme's biological roles .

• Detection of novel peptide metabolites: High-resolution mass spectrometry can identify previously uncharacterized peptide fragments generated by PRCP activity, potentially revealing new signaling molecules or bioactive peptides .

These methodological advances have significantly enhanced our understanding of PRCP's functional versatility and context-dependent activities, opening new avenues for both basic research and therapeutic applications targeting this enzyme.

What contradictions exist in the current literature regarding PRCP function and how might they be resolved?

Several notable contradictions exist in the current literature regarding PRCP function, presenting important opportunities for clarification through further research:

• Enzymatic versus non-enzymatic functions: Some studies suggest PRCP has important non-enzymatic functions through protein-protein interactions, while others focus primarily on its catalytic activity. This apparent contradiction might be resolved through studies using catalytically inactive mutants (S179A/H455A) to distinguish between these roles. By comparing the effects of enzyme inhibition versus protein depletion, researchers could determine which functions require enzymatic activity versus protein presence .

• Tissue-specific roles: There appear to be discrepancies in how PRCP functions across different tissues. While renal studies highlight its role in angiotensin processing , cancer cell studies emphasize signaling pathway regulation . Comprehensive tissue-specific knockout models with controlled microenvironmental conditions could help resolve these apparent differences.

• Physiological versus pathological functions: PRCP's role in normal physiology versus disease states remains incompletely reconciled. The enzyme appears beneficial in some contexts (angiotensin processing) but potentially detrimental in others (cancer cell survival). This contradiction might be addressed through studies examining how PRCP function changes during disease progression, potentially revealing context-dependent regulation.

• pH-dependent activity relevance: While PRCP shows enhanced activity at acidic pH in vitro , the physiological relevance of this property in vivo remains debated. Advanced in vivo pH mapping combined with activity assays could clarify when and where this pH-dependent function becomes significant physiologically.

• Relationship with PREP: Some studies suggest functional redundancy between PRCP and PREP , while others emphasize their distinct substrate preferences. Simultaneous monitoring of both enzymes' activities on a common set of substrates under identical conditions could help resolve these contradictions.

Addressing these contradictions will require multidisciplinary approaches combining genetic models, controlled microenvironmental conditions, advanced analytical techniques, and careful physiological characterization. Such efforts would significantly advance our understanding of PRCP biology and its therapeutic potential.