Prkaa1 Antibody

What is PRKAA1 and what functionalities should researchers target with antibodies?

PRKAA1 (protein kinase AMP-activated catalytic subunit alpha 1) is a key catalytic subunit of AMP-activated protein kinase (AMPK), functioning as an energy sensor that regulates cellular metabolism. The canonical human protein consists of 559 amino acid residues with a molecular mass of approximately 64 kDa, localizing in both nucleus and cytoplasm . When selecting antibodies, researchers should consider:

• Subcellular localization targets (nuclear vs. cytoplasmic fractions)

• Up to 2 different isoforms have been reported, requiring isoform-specific detection

• Expression across diverse tissues including appendix, urinary bladder, and adrenal gland

• PRKAA1 belongs to the CAMK Ser/Thr protein kinase family

For optimal experimental design, targeting specific phosphorylation sites (such as Ser487, Thr172) is critical when studying AMPK activation states rather than merely detecting protein presence .

What are the standard application protocols for PRKAA1 antibodies?

PRKAA1 antibodies are employed across multiple experimental applications with the following methodological considerations:

For paraffin-embedded tissue sections, standardized protocols include: baking at 65°C for 30 min, dewaxing in xylene, hydrating with graded ethanol, and antigen repair by boiling in citrate buffer for 20 min before incubation with primary antibody .

How should researchers approach phospho-specific PRKAA1 antibody selection and validation?

When investigating AMPK activity through phosphorylation states, researchers must carefully consider:

For pThr172/pThr183 antibodies (activation sites):

• These antibodies detect active AMPK and should be validated using both pharmacological activators (e.g., AICAR, metformin) and inhibitors

• Western blot results must be normalized to total PRKAA1 protein

• Phosphatase treatment controls are essential to confirm specificity

For pSer487/pSer496 antibodies (inhibitory sites):

• These detect inhibitory phosphorylation often mediated by AKT pathway

• Validation requires insulin or growth factor treatment to increase phosphorylation

• Purification techniques including peptide affinity chromatography using SulfoLink™ Coupling Resin are recommended for specificity

A critical validation step involves knockdown experiments using shRNA sequences targeting PRKAA1 (e.g., 5'GGGTTCTACCTGCAGCTGAA3', 5'GCGTGTCACCCAGAATGTAG3') .

What methodological approaches are recommended for studying PRKAA1 in tumor microenvironments?

Investigating PRKAA1 in tumor microenvironments requires sophisticated analytical methods:

• Tissue-specific stromal/immune cell separation:

  • Extract stromal vascular fraction (SVF) through collagenase type I (5 mg/ml) digestion

  • Resuspend in FACS buffer (0.5% FBS in PBS)

  • Filter through 70-μm cell strainers

  • Sort CD45+CD31−7-AAD− populations for macrophage analysis

• Correlation analysis with immune markers:

  • Calculate stromal, immune, and ESTIMATE scores using the R package ESTIMATE (version 1.0.13)

  • Assess B cell, T cell CD4, T cell CD8, neutrophil, macrophage, and dendritic cell infiltration using the R package IOBR (version 0.99.9)

  • Use Timer method to reassess infiltration scores

  • Apply Pearson's correlation between PRKAA1 and immune checkpoint pathway marker genes

• Clinical correlation methodologies:

  • Kaplan-Meier survival analysis with log-rank tests to correlate PRKAA1 expression with patient outcomes

  • Cox regression to determine independent prognostic value

  • Spearman's correlation for analyzing the relationship between PRKAA1, tumor mutational load (TMB), and microsatellite instability (MSI)

How does PRKAA1 expression correlate with cancer progression and patient outcomes?

Research has revealed complex relationships between PRKAA1 expression and cancer progression:

When designing experiments to study these effects, researchers should employ multiple cancer cell lines and combine in vitro findings with patient-derived tissue microarrays to establish clinical relevance.

What experimental approaches should be used to investigate PRKAA1's role in metabolic inflammation?

The paradoxical role of PRKAA1 in metabolic inflammation requires sophisticated experimental approaches:

• Endothelial-specific knockout models:

  • EC-specific Prkaa1 knockout mice reveal that PRKAA1 deficiency unexpectedly alleviates high-fat diet (HFD)-induced metabolic syndromes

  • Metabolic parameters to measure include body weight, fat mass composition, glucose levels, and lipid profiles

  • Insulin sensitivity should be analyzed both systemically and in major metabolic organs/tissues

• Mechanistic investigation in cell culture:

  • PRKAA1 knockdown in endothelial cells reduces glycolysis and fatty acid oxidation

  • Measure acetyl-CoA levels and assess transcription of inflammatory molecules

  • Investigate ATP citrate lyase and histone acetyltransferase p300 as downstream mediators

• Monocyte adhesion assays:

  • PRKAA1 metabolically regulates monocyte/macrophage recruitment

  • AMPKα1/PRKAA1-regulated metabolism supports monocyte recruitment and macrophage viability

  • These effects contribute to the development of diet-induced metabolic inflammation

When designing these experiments, researchers must consider the pro-inflammatory effect of endothelial AMPKα1/PRKAA1 in a metabolic context, which contradicts its traditionally understood role.

What are the established protocols for generating and validating PRKAA1 knockdown models?

To effectively study PRKAA1 function through knockdown approaches:

• Design of shRNA constructs:

  • Target sequences: 5'GGGTTCTACCTGCAGCTGAA3', 5'GCGTGTCACCCAGAATGTAG3'

  • Negative control sequence: 5'TTCTCCGAACGTGTCACGT3'

  • Subclone into lentiviral expression vectors containing reporter genes (e.g., GFP)

• Lentiviral transduction protocol:

  • Perform according to manufacturer's instructions

  • Screen cells with 2 μg/mL puromycin for 7 days

  • Select stable strains for subsequent experiments

• Validation of knockdown efficiency:

  • Western blot analysis to confirm protein reduction

  • qRT-PCR using specific primers:

    • PRKAA1 forward: 5'TTGAAACCTGAAAATGTCCTGCT3'

    • PRKAA1 reverse: 3'GGTGAGCCACAACTTGTTCTT5'

    • Normalize to GAPDH expression

• Functional validation:

  • Assess cellular phenotypes including proliferation, migration, and invasion

  • Evaluate downstream pathway activation (e.g., PI3K/AKT signaling)

  • Test sensitivity to pathway-specific inhibitors (e.g., AKT inhibitors MK2206 and GSK2110183)

How can researchers effectively investigate PRKAA1's interaction with the PI3K/AKT pathway?

To study the interplay between PRKAA1 and the PI3K/AKT pathway:

• Pathway component assessment:

  • Western blot analysis of PI3K, AKT, and phosphorylated forms (p-AKT)

  • Compare pathway activation in PRKAA1 overexpression versus knockdown models

  • Use PRKAA1 mutants (catalytically inactive, phospho-mimetic) to delineate kinase-dependent effects

• Inhibitor studies:

  • Treat cells with AKT inhibitors (MK2206, GSK2110183)

  • Compare sensitivity between PRKAA1 overexpression and control groups

  • Research shows PRKAA1 overexpression groups are less sensitive to AKT inhibitors

• Rescue experiments:

  • Reverse PRKAA1 knockdown phenotypes with constitutively active AKT constructs

  • Combine PRKAA1 activators (e.g., AICAR, metformin) with PI3K/AKT inhibitors

  • Monitor cellular outcomes including proliferation, migration, and metabolic profiles

• Temporal dynamics analysis:

  • Time-course experiments to determine sequence of activation events

  • Pulse-chase approaches to track signaling cascade progression

  • Single-cell techniques to capture heterogeneity in pathway activation

Understanding this interaction is critical as it reveals how PRKAA1 may regulate cancer progression and provides insight into potential therapeutic strategies targeting this relationship.

What are the common technical challenges in PRKAA1 antibody-based experiments and how can they be addressed?

Researchers frequently encounter several technical issues when working with PRKAA1 antibodies:

• Cross-reactivity with PRKAA2:

  • Many antibodies detect both AMPK alpha 1 (PRKAA1) and AMPK alpha 2 (PRKAA2)

  • Solution: Use isoform-specific antibodies targeting unique regions or validate with knockout controls

  • Example: Some commercial antibodies recognize both isoforms (e.g., catalog #10929-2-AP)

• Inconsistent phosphorylation detection:

  • Phospho-specific antibodies may show variable results due to rapid dephosphorylation

  • Solution: Include phosphatase inhibitors in lysis buffers and perform sample preparation at 4°C

  • Use fresh samples and avoid freeze-thaw cycles that may affect phosphorylation status

• Background in immunohistochemistry:

  • Non-specific binding can complicate tissue staining interpretation

  • Solution: Optimize blocking with 10% bovine serum albumin and include proper negative controls

  • For paraffin sections, thorough antigen retrieval by boiling in citrate buffer for 20 minutes is critical

• Western blot band size variability:

  • The observed molecular weight may vary from the calculated 64 kDa

  • Some antibodies detect bands at 80 kDa for phosphorylated forms

  • Solution: Include positive controls and validate with recombinant proteins or knockdown samples

How should researchers approach comparative analysis of different PRKAA1 antibodies for specific applications?

When selecting between multiple PRKAA1 antibodies, employ the following systematic approach:

• Epitope mapping comparison:

  • C-terminal antibodies (AA 474-502, 451-550) for total protein detection

  • Specific phosphorylation sites (pThr172/183, pSer487/496) for activity assessment

  • Catalytic domain antibodies (AA 325-543) for functional studies

• Application-specific selection criteria:

  • For WB: Polyclonal antibodies may offer higher sensitivity but potentially more background

  • For IHC: Monoclonal antibodies typically provide more consistent results with less batch variation

  • For IP: Consider antibodies raised against native protein rather than denatured epitopes

• Validation methodology:

  • Perform side-by-side comparison with multiple antibodies

  • Include negative controls (knockdown/knockout samples)

  • Test with recombinant protein or overexpression systems

  • Validate across multiple cell types and tissue samples

• Documentation of antibody performance:

  • Create a standardized scoring system for sensitivity, specificity, and reproducibility

  • Document optimal conditions for each application (dilution, incubation time, temperature)

  • Record lot-to-lot variation to maintain experimental consistency