prkra Antibody

What is PRKRA and what are its main functions in cellular pathways?

PRKRA serves multiple critical functions in cells:

• Activates EIF2AK2/PKR in the absence of double-stranded RNA (dsRNA), leading to phosphorylation of EIF2S1/EIF2-alpha, inhibition of translation, and induction of apoptosis

• Required for siRNA production by DICER1 and subsequent siRNA-mediated post-transcriptional gene silencing

• Involved in innate immune response against viral infections by recognizing viral dsRNA

• Promotes UBC9-p53/TP53 association, sumoylation, and phosphorylation of p53/TP53 at 'Lys-386' and 'Ser-392', enhancing its activity in a PKR-dependent manner

• Recently discovered to act as a dsRNA sensor in embryonic cells, mediating translation inhibition independent of PKR

What types of PRKRA antibodies are commercially available for research?

Various types of antibodies targeting PRKRA are available:

What considerations should be made when selecting PRKRA antibodies for specific experimental applications?

When selecting PRKRA antibodies, consider:

• Application compatibility: Ensure the antibody is validated for your specific application (WB, IP, IHC, IF, etc.)

• Species reactivity: Verify cross-reactivity with your model organism

• Epitope specificity: For studies on specific domains or mutations, select antibodies targeting relevant regions

• Clonality: Monoclonal antibodies offer consistent results but recognize a single epitope, while polyclonal antibodies provide stronger signals by recognizing multiple epitopes

• Validation: Check if the antibody has been validated in knockout/knockdown models

How can I validate the specificity of PRKRA antibodies in my research?

Rigorous validation should include:

• Knockout verification: Test the antibody in PRKRA knockout samples. As demonstrated in , a specific PRKRA antibody should show no signal in knockout cell lysates but maintain signal in wild-type samples.

• Peptide competition assay: Pre-incubate antibody with immunizing peptide before application. As shown in , this should block specific binding, resulting in signal loss at the expected molecular weight.

• siRNA knockdown: Verify signal reduction correlates with PRKRA knockdown efficiency

• Molecular weight confirmation: PRKRA's predicted band size is 34 kDa, though additional bands at ~60 kDa may appear in some cell types

• Multiple antibody verification: Use antibodies targeting different epitopes to confirm results

What are the optimal techniques for studying PRKRA-PKR interactions using antibodies?

For investigating PRKRA-PKR interactions:

• Co-immunoprecipitation (co-IP): Use anti-PRKRA antibodies to pull down the protein complex and probe for PKR in western blots, or vice versa

• Proximity ligation assay (PLA): Detect in situ protein interactions with high sensitivity and specificity

• Mammalian two-hybrid analysis: As used in , this technique can quantitatively measure PRKRA-PKR interactions in intact cells

• Cross-linking followed by immunoprecipitation: Stabilize transient interactions before IP

Research from demonstrated that DYT-PRKRA mutations (P222L) enhance PRKRA-PKR interaction, and the interaction can be disrupted by compounds like luteolin.

How can I investigate the role of PRKRA in dsRNA sensing and antiviral pathways?

Advanced methodologies include:

• RNA-IP: As described in , use anti-PRKRA antibodies to immunoprecipitate PRKRA-bound RNAs, followed by dot blot analysis with streptavidin-HRP to visualize biotin-labeled dsRNAs

• dsRNA binding assays: Immobilize dsRNA on agarose beads and analyze PRKRA binding using specific antibodies

• PKR activity assays: Measure PKR activation by PRKRA using γ-32P-ATP incorporation assays

• CRISPR/Cas9 knockout models: Generate PRKRA knockout cells using validated sgRNAs to study loss-of-function effects

• Recombinant protein studies: Use purified PRKRA and mutant variants to study direct effects on PKR activation

What approaches are recommended for studying PRKRA's role in disease models?

For disease-related research:

• Patient-derived samples: Compare PRKRA expression and function between patient and control samples using validated antibodies

• Animal models: Utilize PRKRA knockout or mutant mice to study phenotypes

• Organoid cultures: Establish PRKRA knockout organoids to study tissue-specific effects, as demonstrated in pancreatic cancer research

• Cell line panels: Compare PRKRA expression across different cancer or disease-relevant cell lines

• Drug intervention studies: Examine how compounds affecting PRKRA function impact disease phenotypes

Research in showed that PRKRA knockout significantly reduced pancreatic cancer organoid growth and increased chemosensitivity to gemcitabine.

What are the optimal Western blotting conditions for PRKRA detection?

For optimal Western blot results:

• Sample preparation: Use RIPA buffer for protein extraction

• Protein loading: Load 10-20 μg of total protein per lane

• Gel percentage: Use 10-12% SDS-PAGE gels to resolve the 34 kDa PRKRA protein

• Antibody dilution: Typically 1:1000 for primary antibodies

• Blocking: 5% BSA in TBST is commonly used

• Expected bands: Primary band at 34-36 kDa; some antibodies may detect additional bands at ~60 kDa

• Loading controls: GAPDH or β-actin are suitable

• Visualization systems: Both chemiluminescence and fluorescence-based detection (IRDye systems) work well

How can I optimize immunoprecipitation protocols for PRKRA studies?

For successful PRKRA immunoprecipitation:

• Antibody amount: Use 5 μg of specific PRKRA antibody per IP reaction

• Beads: Both protein G magnetic beads and agarose beads are effective

• Lysate amount: 0.5-1 mg of total protein is typically sufficient

• Incubation conditions: Incubate antibodies with beads under agitation for 10 min, followed by lysate addition and further incubation for 10 min

• Elution: SDS loading buffer with heating at 70°C for 10 min works well

• Controls: Include a no-antibody control to assess non-specific binding

• Detection: Use light chain-specific secondary antibodies to avoid heavy chain interference

What considerations are important when designing CRISPR/Cas9 knockout strategies for PRKRA?

When designing PRKRA knockout experiments:

• sgRNA design: Target conserved exons present in all splice variants; validated sgRNA sequences include GTCACCAACGGTTACTCTGA and GGCGAAACATAGAGCTGCAG

• Validation methods: Confirm knockout by RT-qPCR, Western blot, and in situ hybridization

• Controls: Include non-targeting sgRNA controls (e.g., CGCTTCCGCGGCCCGTTCAA)

• Delivery system: Lentiviral systems with appropriate selection markers (puromycin, neomycin) are effective

• Cell line consideration: Some cell types may be more amenable to editing than others

• Phenotypic assessment: Measure proliferation, migration, and stress responses to comprehensively characterize knockout effects

How should I approach studying PRKRA mutations in relation to disease mechanisms?

For mutation-focused research:

• Site-directed mutagenesis: Generate specific mutations (e.g., P222L associated with dystonia)

• Expression systems: Compare wild-type and mutant PRKRA in appropriate cellular models

• Functional assays: Assess dsRNA binding, PKR activation, and protein-protein interactions

• Structural analysis: Consider using computational predictions (e.g., AlphaFold) to understand structural impacts

• Patient samples: When available, compare with healthy controls using validated antibodies

• Animal models: Create knock-in models of specific mutations to study in vivo effects

Research in showed that the P222L mutation enhances PRKRA-PKR interaction and increases PKR activation, contributing to dystonia pathology.

How can PRKRA antibodies be used to investigate its novel role in translational regulation in embryonic cells?

Recent discoveries require specialized approaches:

• Polysome profiling: Couple with PRKRA immunoprecipitation to study translational complexes

• 43S preinitiation complex analysis: Investigate PRKRA's effect on translation initiation as described in

• eIF2 complex interaction studies: Use antibodies to study PRKRA's sequestration of eIF2 complex components

• Puromycin incorporation assays: Measure global translation rates in the presence/absence of PRKRA

• Embryonic model systems: Utilize zebrafish embryos and mouse embryonic stem cells as described in

Research in revealed that PRKRA dimerizes and sequesters the eIF2 complex away from translation machinery, representing a PKR-independent mechanism of translation inhibition.

What methodologies are recommended for investigating PRKRA's role in cancer progression and chemoresistance?

Cancer research approaches include:

• Expression correlation: Compare PRKRA levels in normal versus tumor tissues using validated antibodies

• Pathway analysis: Study PRKRA's relationship with NF-κB and MMP1 in cancer cells

• ChIP assays: Investigate transcriptional regulation mechanisms

• Drug sensitivity assays: Measure cell survival after chemotherapy with or without PRKRA knockdown/overexpression

• Xenograft models: Assess tumor growth and drug response in vivo with PRKRA manipulation

• Patient outcome correlation: Analyze PRKRA expression in relation to clinical prognosis

Research in established that PRKRA promotes pancreatic cancer progression via the NF-κB/MMP1 axis and reduces sensitivity to gemcitabine.

How can I study PRKRA dimerization and its functional significance?

To investigate PRKRA dimerization:

• Co-immunoprecipitation: Express differently tagged PRKRA variants (e.g., 6xmyc-PRKRA and 6xHis-PRKRA) and perform co-IP

• Structural prediction: Utilize computational tools like AlphaFold3 to predict dimer interfaces

• Mutational analysis: Target the dsRBD3 domain identified as critical for dimerization

• Cross-linking studies: Use chemical cross-linkers to stabilize dimers prior to detection

• Functional assays: Compare activities of wild-type and dimerization-deficient mutants

• In vitro reconstitution: Use purified recombinant proteins to study dimerization in a controlled system

Research in demonstrated that PRKRA dimerizes through its dsRBD3 domain, which is critical for its function in translational regulation.