PROKR1 Antibody

What is the recommended sample preparation protocol for optimal PROKR1 detection in Western blot applications?

For optimal PROKR1 detection in Western blot applications, tissues or cells should be lysed in appropriate buffer conditions. Based on published protocols, extraction should be performed using PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide . For brain samples, membrane preparations typically yield better results than whole cell lysates. Western blot analysis of rat brain membranes and mouse brain lysate has been successfully performed using anti-PROKR1 antibodies at 1:200 dilution . To ensure specificity, negative controls using the antibody preincubated with PROKR1 blocking peptide are strongly recommended. When working with reproductive tissues, proper tissue homogenization and denaturing conditions are particularly important due to high lipid content.

What are the optimal fixation protocols for PROKR1 immunohistochemistry in different tissue types?

Fixation protocols for PROKR1 immunohistochemistry vary by tissue type. For paraffin-embedded tissues, standard dewaxing and rehydration in graded ethanol followed by antigen retrieval in citrate buffer is recommended . For frozen sections such as dorsal root ganglion (DRG), fixation in 4% paraformaldehyde followed by permeabilization has been successful . For dual immunofluorescence protocols, blocking with 5% normal horse serum (for PROKR1/COX-2 colocalization) or 5% normal goat serum (for PROKR1/CD31 endothelial cell marker) is advised . For triple immunohistochemistry involving IL-11Rα, PROKR1, and IL-11, sequential antibody application with intermediate antigen retrieval steps yields optimal results .

Which regions of the PROKR1 protein are most immunogenic for antibody development?

The extracellular N-terminus of PROKR1 has proven to be highly immunogenic and effective for antibody development. Specifically, peptides corresponding to amino acid residues 10-24 of rat PROKR1 (sequence: ENTTNTFTDFFSARD) have been used to generate specific antibodies with cross-reactivity to human, mouse, and rat PROKR1 . For human-specific antibodies, immunogens derived from the Met1-Lys393 region (full extracellular domain) of human PROKR1 (Accession # Q8TCW9) produced in NS0 mouse myeloma cell lines have generated highly specific monoclonal antibodies . For the detection of intracellular epitopes, the human PKR1 region between amino acids 19-68 has been effectively used as an immunogen .

How can I validate the specificity of PROKR1 antibodies for my research application?

To validate PROKR1 antibody specificity, a multi-tiered approach is recommended:

• Blocking peptide validation: Pre-incubate the antibody with the immunogenic peptide before application. This should abolish specific signal in Western blot and immunohistochemistry applications .

• Isotype control comparison: For flow cytometry applications, compare staining with isotype control antibodies (e.g., MAB0041 for mouse IgG2B) .

• Knockout/knockdown validation: When available, test the antibody on tissues or cells with PROKR1 knockout/knockdown. This can be accomplished using lentiviral miRNA constructs targeting PROKR1 as demonstrated in decidual tissue experiments .

• Cross-platform validation: Confirm PROKR1 expression using multiple detection methods (e.g., qRT-PCR and Western blot) to corroborate antibody-based findings.

• Expression pattern match: Verify that observed staining patterns match known PROKR1 expression profiles, such as in endothelial cells of microvasculature, glandular epithelium, and specific brain regions .

What are effective approaches for multiplexed detection of PROKR1 with other signaling pathway components?

For multiplexed detection of PROKR1 with associated signaling components, several methodological approaches have proven effective:

• Dual immunofluorescence: This has been successfully employed to colocalize PROKR1 with COX-2 or CD31 (endothelial marker) using sequential antibody application with appropriate blocking steps between applications .

• Triple immunohistochemistry: For simultaneous detection of PROKR1, IL-11, and IL-11Rα, a protocol using sequential antibody application with intermediate antigen retrieval and blocking steps has been established. This employs different fluorochromes (cyanide 3 and cyanide 5) for signal differentiation .

• Flow cytometry multiplexing: PROKR1 antibodies conjugated with mFluor Violet 500 SE have been validated for flow cytometry and CyTOF applications, enabling multi-parameter analysis with other cellular markers .

• Co-immunoprecipitation: For detecting PROKR1 interactions with downstream signaling molecules, immunoprecipitation with Myc-tagged ERK followed by Western blot analysis has been demonstrated in cells cotransfected with dominant-negative isoforms of signaling components .

What are the critical parameters for optimizing PROKR1 detection in flow cytometry applications?

For optimal PROKR1 detection by flow cytometry, several critical parameters must be considered:

• Cell preparation: Live, intact cells are preferred for surface detection of PROKR1. Human blood-derived monocytes and mouse J774 macrophage cells have been successfully used for flow cytometric detection of PROKR1 .

• Antibody selection: Monoclonal antibodies with validated specificity for the extracellular domain of PROKR1 (such as clone 420849) yield more consistent results than polyclonal alternatives .

• Secondary detection system: For unconjugated primary antibodies, Allophycocyanin-conjugated Anti-Mouse IgG F(ab')2 secondary antibodies have been successfully employed, with appropriate isotype controls .

• Direct conjugation options: For multiplexed analysis, directly conjugated antibodies such as mFluor Violet 500 SE-conjugated anti-PROKR1 eliminate cross-reactivity concerns with secondary antibodies .

• Controls: Proper controls include isotype-matched antibodies (e.g., MAB0041 for mouse IgG2B), secondary-only controls, and when possible, PROKR1-negative cell populations .

How can discrepancies in PROKR1 molecular weight across different tissues be addressed methodologically?

Discrepancies in PROKR1 molecular weight across tissues can be methodologically addressed through several approaches:

• Differential glycosylation analysis: PROKR1 is a glycoprotein, and tissue-specific glycosylation patterns can alter apparent molecular weight. Treatment with deglycosylation enzymes (PNGase F or Endoglycosidase H) before Western blot can determine if glycosylation accounts for weight variations.

• Membrane preparation optimization: For brain tissues, membrane preparation protocols have shown higher specificity than whole cell lysates . Different membrane extraction protocols may be necessary for various tissue types.

• Isoform-specific detection: The PROKR1 gene (previously known as GPR73) has multiple aliases and previous identifiers that may represent different splice variants . Designing primers or selecting antibodies that target conserved regions can help standardize detection.

• Sample preparation standardization: Variations in sample preparation, particularly in detergent selection and denaturation conditions, can affect protein migration. Standardized protocols using consistent detergent types and concentrations are recommended for cross-tissue comparisons.

• Validation with recombinant protein: Including recombinant PROKR1 protein of known molecular weight as a positive control can help calibrate tissue-specific variations.

What are the methodological considerations for investigating PROKR1-mediated signaling in reproductive tissues?

Investigation of PROKR1-mediated signaling in reproductive tissues requires several methodological considerations:

• Tissue-specific signaling pathway analysis: In endometrial epithelial cells, PROKR1 activation by PROK1 leads to inositol phosphate production and phosphorylation of cSrc, EGFR, and ERK1/2 . Experimental designs should include phospho-specific antibodies for these targets.

• Temporal dynamics: Time-course experiments are crucial as PROK1 induces gene expression changes with different kinetics. For instance, treatment of Ishikawa PROKR1 cells with 40 nM PROK1 for 8 hours revealed 49 differentially regulated genes .

• Downstream functional validation: For reproductive tissues, measurement of prostaglandin synthesis (PGE2 and PGF2α by ELISA) following PROK1 treatment provides functional validation of PROKR1 activity .

• Signaling inhibition approach: Using inhibitors of Gq-phospholipase C-β, cSrc, EGFR and MEK pathways can delineate specific contributions of each signaling component to PROKR1-mediated responses .

• Regulatory protein considerations: The regulator of calcineurin 1 isoform 4 (RCAN1-4) has been identified as a negative regulator in calcineurin-mediated signaling downstream of PROKR1. Adenoviral overexpression of RCAN1-4 can be used to modulate this pathway .

How should researchers approach contradictory findings regarding PROKR1 expression in immune cells?

To address contradictory findings regarding PROKR1 expression in immune cells, researchers should implement the following methodological approaches:

• Cell subset purification: Isolation protocols significantly impact detection. For uterine natural killer (uNK) cells, established isolation protocols have successfully detected PROK1 but not PROKR1 expression . Flow cytometry on J774 macrophages and human monocytes has verified PROKR1 surface expression . Each immune cell subset may require tailored isolation methods.

• Multiple detection methodologies: Combining transcript analysis (RT-PCR) with protein detection methods (flow cytometry, immunohistochemistry) provides more robust evidence of expression or absence.

• Activation state considerations: PROKR1 expression may vary with cellular activation status. Experimental designs should document and control for activation markers when assessing PROKR1 expression.

• Primer and antibody validation: For RT-PCR analysis, primers should be validated against positive control tissues. Recommended primer pairs include:

  • PROKR1 forward: 5′-GGA TCC AGG CTT GAT GGA GAC CAC CAT GGG G-3′

  • PROKR1 reverse: 5′-CTC GAG GAT ATC TTT TAG TCT GAT GCA GTC CAC CT-3′

• Cross-species considerations: Expression patterns may differ between species. Human, mouse, and rat PROKR1 homologs share high sequence identity but may have species-specific expression patterns in immune cell subsets .

What experimental approaches can reliably distinguish between PROKR1 and PROKR2 signaling in tissues expressing both receptors?

Distinguishing between PROKR1 and PROKR2 signaling in tissues expressing both receptors requires strategic experimental approaches:

• Receptor-specific knockdown: Lentiviral miRNA constructs targeting PROKR1 have been used to selectively abolish PROKR1 expression without affecting PROKR2 . Similar approaches can be applied for PROKR2-specific knockdown.

• Selective agonists/antagonists: While both receptors bind prokineticins 1 and 2, development of receptor-subtype selective ligands can help differentiate signaling. When available, these should be validated for selectivity before application.

• Receptor-specific antibodies for neutralization: Antibodies recognizing extracellular epitopes of PROKR1 can be used to selectively block ligand binding. The antibody targeting amino acids 10-24 of the extracellular N-terminus has been validated for such applications .

• Heterologous expression systems: Stable transfection of PROKR1 in Ishikawa cells has been used to isolate PROKR1-specific signaling events . Similar approaches with PROKR2 can enable comparative analysis.

• Pathway component analysis: Although both receptors can activate similar pathways, differential coupling to specific G-protein subtypes or recruitment of distinct scaffolding proteins may occur. Phosphoproteomic analysis following selective stimulation can reveal receptor-specific phosphorylation signatures.

What are the critical methodological considerations for studying PROKR1 involvement in inflammatory responses?

Studying PROKR1 involvement in inflammatory responses requires several methodological considerations:

• Temporal dynamics: In mouse models of inflammation, fetal membranes collected 6 hours after intrauterine injection with PROK1 showed significant increases in pro-inflammatory cytokines. Time course studies are essential to capture the full inflammatory response profile .

• Cytokine profiling: PROK1 treatment significantly increases expression of specific cytokines including IL-6, IL-1β, TNF, CXCL2, and CXCL5. Comprehensive cytokine profiling through gene expression analysis and protein detection (ELISA) is recommended .

• Tissue specificity: Inflammatory responses to PROKR1 activation may be tissue-specific. In fetal membranes, PROK1 treatment increased cytokine expression but not prostaglandin synthase 2 (PTGS2/COX2) expression, unlike LPS treatment which elevated both .

• Protein quantification in biological fluids: ELISA quantification of inflammatory mediators in amniotic fluid following PROK1 treatment provides functional validation of the inflammatory response. Validated ELISA protocols for mouse IL1B, TNF, and CXCL2 have been established .

• In vivo vs. in vitro response comparison: Comparisons between cultured cells and tissue explants are important, as the inflammatory microenvironment contains multiple cell types that may modulate the response. In vivo mouse models with intrauterine injection provide the most comprehensive picture .

How can researchers quantitatively assess PROKR1-mediated angiogenic effects in experimental models?

For quantitative assessment of PROKR1-mediated angiogenic effects, researchers should consider these methodological approaches:

• Endothelial cell marker co-localization: PROKR1 expression in endothelial cells of the microvasculature can be confirmed by co-localization with CD31 (endothelial marker) using dual immunofluorescence techniques .

• Tube formation assays: Quantitative assessment of endothelial cell tube formation on basement membrane extracts following PROK1 treatment can measure angiogenic potential in vitro.

• Phosphorylation cascade analysis: Since PROKR1 activation leads to phosphorylation of signaling components involved in angiogenesis (including ERK1/2), quantitative Western blot analysis using phospho-specific antibodies provides a biochemical readout of angiogenic signaling .

• Gene expression profiling: PROK1-PROKR1 signaling regulates angiogenic genes. Quantitative RT-PCR using validated primers for VEGF, angiopoietins, and their receptors can assess transcriptional regulation of the angiogenic program.

• In vivo angiogenesis models: Matrigel plug assays with PROK1 or controlled-release formulations can assess microvascular density in vivo. Vessel quantification should include both vessel number and vessel area measurements.

What are the recommended TaqMan qRT-PCR conditions for reliable PROKR1 transcript quantification across different tissues?

For reliable PROKR1 transcript quantification across different tissues, these TaqMan qRT-PCR conditions are recommended:

• RNA extraction protocol: Total RNA should be extracted using QIAzol lysis reagent, phase lock tubes, and the RNeasy mini kit with on-column DNase digestion to eliminate genomic DNA contamination .

• cDNA synthesis: The Superscript VILO cDNA synthesis kit has been validated for reverse transcription of PROKR1 mRNA .

• Primer and probe sequences: Validated primer-probe sets include:

  • PROKR1 forward: TCTTACAATGGCGGTAAGTCCA

  • PROKR1 reverse: CTCTTCGGTGGCAGGCAT

  • PROKR1 probe (FAM): TGCAGACCTGGACCTCAAGACAATTGG

• Reference gene normalization: Expression should be normalized for RNA loading using appropriate housekeeping genes. Beta-actin (ACTB) with JOE-labeled probe has been validated as a reference gene for PROKR1 expression studies .

• Relative quantification: Relative expression should be calculated against a tissue known to express PROKR1 (e.g., brain tissue for most species) to enable cross-tissue comparisons .

• PCR conditions: Reactions should be carried out using Applied Biosystems instruments (7500 or 7900 Fast) with manufacturer-recommended cycling conditions for TaqMan assays .