PRSS28 Mouse

What is PRSS28 and what is its expression pattern in mice?

PRSS28, also known as implantation serine proteinase 1 (Isp1), is a member of a serine proteinase gene family located within a tryptase cluster on chromosome 17 of the mouse genome . This protein is expressed specifically and abundantly in the glandular epithelium (GE) of the mouse uterus . Its expression is induced by progesterone and begins around gestational day (GD) 5.5, which correlates with the timeframe when uterine glands influence pregnancy establishment through effects on stromal cell decidualization .

The specificity of PRSS28 expression to uterine glands makes it a valuable marker for studying endometrial gland function. Immunohistochemical analysis using specific antibodies against PRSS28 can be used to visualize its expression pattern in tissue sections. For comprehensive expression analysis, researchers should collect uterine tissues during different stages of the estrous cycle, as PRSS28 is abundantly expressed during the proestrus phase .

How is PRSS28 regulated in the mouse uterus?

PRSS28 expression is regulated by two primary factors:

• Progesterone signaling: PRSS28 is a progesterone-induced gene in the uterine glands . This hormonal regulation explains its temporal expression pattern during early pregnancy.

• FOXA2 transcriptional control: Forkhead box A2 (FOXA2) is a transcription factor expressed specifically in the endometrial glandular epithelium of mice . ChIP-seq studies have established that PRSS28 has FOXA2 binding sites in its gene promoter/enhancer regions . In FOXA2 conditional knockout (cKO) mice, PRSS28 expression is absent, confirming FOXA2's role as a critical regulator of PRSS28 transcription .

This dual regulation by both hormonal and transcriptional mechanisms allows for precise temporal and spatial control of PRSS28 expression in the uterine environment. Researchers studying PRSS28 regulation should consider both progesterone receptor signaling and FOXA2-mediated transcriptional activation pathways in their experimental designs.

What genomic techniques are recommended for PRSS28 gene characterization?

For comprehensive genomic characterization of PRSS28, researchers should employ a combination of approaches:

• Promoter analysis: Use bioinformatic tools to identify conserved regulatory elements in the PRSS28 promoter region. ChIP-seq data has confirmed FOXA2 binding sites in the promoter/enhancer regions of PRSS28 .

• Gene structure analysis: The PRSS28 gene contains six exons with coding sequences beginning in the second exon . PCR-based approaches with appropriate primers spanning exon-intron boundaries can be used to validate gene structure.

• Expression profiling: Quantitative RT-PCR using PRSS28-specific primers can quantify expression levels across various reproductive states and experimental conditions . Primer sequences should be carefully designed to ensure specificity.

• Comparative genomics: Analysis of sequence conservation with the related PRSS29 gene (46% DNA sequence similarity) can provide insights into functional domains and potential redundant functions .

How should I design CRISPR-Cas9 guides for targeted PRSS28 deletion?

When designing CRISPR-Cas9 guides for PRSS28 deletion, follow these methodological steps:

• Guide RNA selection: Design guide RNAs that are unique in the genome to avoid off-target effects. Recommended online tools include those provided by Integrated DNA Technologies (IDT) .

• Strategic targeting: For comprehensive PRSS28 deletion, target multiple exons. In the published research, two guide RNAs were successfully used - one targeting exon 2 (containing the start codon) with sequence GAACACGGTACTTTCCAGACAGG and another targeting exon 4 with sequence TCGACTCCACTGACCAGTGTTGG .

• Deletion strategy: Design guides to create a large deletion by cutting at two distant sites. In the reported study, guides created a deletion of 876 base pairs, removing the start codon and effectively knocking out the gene .

• Validation primers: Design PCR primers flanking the targeted deletion site to allow for easy genotyping of wild-type, heterozygous, and homozygous mutant mice .

What is the optimal protocol for RNP assembly in PRSS28 gene editing?

For successful ribonucleoprotein (RNP) assembly when targeting PRSS28, follow this detailed protocol:

• Component preparation:

  • Purchase ALT-R® CRISPR-Cas9 tracrRNAs and ALT-R® S.p. Cas9 Nuclease V3 from a reliable supplier (such as IDT)

  • Prepare crRNA guides at 100 μM concentration

• crRNA:tracrRNA duplex formation:

  • Mix tracRNA and each crRNA at 100 μM concentration

  • Anneal the mixture on a thermal cycler at 95°C for 5 minutes

  • Cool the mixture to room temperature

• RNP complex assembly:

  • Combine crRNA:tracrRNA duplex (6 μM final concentration) with Cas9 Nuclease (1.2 μM final concentration)

  • Constitute in Opti-MEM to a total volume of 60 μl

  • Incubate at room temperature for 20 minutes

• Delivery:

  • Use 50 μl of RNP mix for electroporation of mouse zygotes following established protocols

This approach has been validated for successful deletion of PRSS28 and can be adapted for similar gene editing experiments targeting related genes.

What breeding strategies should I employ for studying PRSS28 function?

Effective breeding strategies for PRSS28 functional studies include:

• Initial heterozygous breeding: After generating founder mice with PRSS28 mutations, establish breeding pairs of heterozygous males and females to produce all possible genotypes (wild-type, heterozygous, and homozygous null) in the expected Mendelian ratios .

• Genotype confirmation: Implement a reliable genotyping strategy using PCR with primers flanking the deletion site, followed by gel electrophoresis to distinguish between genotypes . Confirm deletions by Sanger sequencing.

• Fertility testing:

  • Set up various breeding combinations (wild-type × wild-type, null × null, null × wild-type) and monitor reproductive performance over an extended period (6 months recommended)

  • Track key parameters including litter size, litter frequency, and pup survival to weaning

• Double knockout breeding: To address potential functional redundancy between PRSS28 and related proteins (such as PRSS29), generate double knockout mice by crossing single knockout lines .

• Control for estrous cycle: When analyzing uterine phenotypes, collect tissues at defined estrous cycle stages (preferably proestrus for PRSS28 studies) to control for cyclical variations in gene expression .

What reproductive phenotypes are observed in PRSS28 knockout mice?

Contrary to initial hypotheses about PRSS28's role in reproduction, PRSS28 knockout mice exhibit normal fertility parameters:

• Normal embryonic development: PRSS28 null mice develop normally with no obvious developmental defects .

• Preserved fertility: Female mice lacking PRSS28 are fertile with no significant differences in reproductive performance compared to wild-type controls .

• Normal litter sizes: The average litter size from PRSS28 null-null matings (6.1 ± 1.8) does not differ significantly from wild-type matings (6.0 ± 1.3) .

• Mendelian inheritance: Genotypic distribution of pups from heterozygous matings follows expected Mendelian ratios, indicating no selective disadvantage for PRSS28 null embryos .

These findings indicate that despite its specific expression pattern in uterine glands and regulation by progesterone and FOXA2, PRSS28 is dispensable for female fertility in laboratory mice under standard vivarium conditions.

How should I evaluate uterine histology in PRSS28 mutant mice?

For comprehensive histological analysis of uterine tissues in PRSS28 mutant mice, follow these methodological steps:

Does combined deletion of PRSS28 and PRSS29 affect mouse reproduction?

The combined deletion of both PRSS28 and PRSS29 does not significantly impact mouse reproduction:

• Double knockout generation: Due to the 46% DNA sequence similarity between PRSS28 and PRSS29 and their shared expression patterns, researchers generated double knockout mice to address potential functional redundancy .

• Normal fertility in double knockouts: When double homozygous PRSS28/PRSS29 mutant females were bred with wild-type males, the average litter size (5.9 ± 2.4) was not significantly different from wild-type matings (6.0 ± 1.3) .

• No compensatory expression: Gene expression analysis revealed no compensatory upregulation of PRSS28 in PRSS29 knockout mice or vice versa, confirming the complete absence of both proteins in the double knockout model .

This finding is particularly significant as it demonstrates that even eliminating both members of this serine proteinase family does not compromise reproductive function, suggesting either additional compensatory mechanisms or that these proteins are dispensable for fertility under standard laboratory conditions.

How do researchers address potential functional redundancy in PRSS28 studies?

Addressing functional redundancy in PRSS28 research requires sophisticated experimental approaches:

• Double knockout models: Generate combined PRSS28/PRSS29 knockout mice to eliminate potential compensation between these 46% sequence-similar proteins .

• Gene expression profiling: Perform comprehensive transcriptomic analysis (RNA-seq) to identify potential compensatory upregulation of other serine proteases or functionally related genes in PRSS28 knockout mice.

• Broader gene family analysis: Consider the entire tryptase cluster on chromosome 17 where PRSS28 resides, as other members might provide functional compensation .

• Environmental challenges: Test knockout models under various stress conditions beyond standard vivarium environments, as phenotypes may only manifest under specific challenges .

• Tissue-specific and inducible deletions: Use conditional knockout approaches (e.g., FOXA2-Cre for gland-specific deletion) to avoid developmental compensation that might occur in germline knockouts.

These approaches collectively address the potential limitations of single gene knockout studies and provide more comprehensive insights into the functional roles of PRSS28 in reproductive physiology.

What environmental or experimental conditions might reveal PRSS28 functions not observed in standard laboratory settings?

Standard vivarium conditions may mask potential functions of PRSS28 that would be evident under different environmental or physiological challenges:

• Pathogen exposure: Since proteases are often involved in host defense mechanisms, PRSS28 function might become apparent during reproductive tract infections or inflammatory conditions .

• Nutritional stress: Assess reproductive performance under various nutritional challenges, as proteases may play roles in nutrient utilization or adaptation to resource limitations.

• Advanced maternal age: Test PRSS28 knockout females at advanced reproductive ages when compensatory mechanisms might be less robust.

• Repeated pregnancy studies: Examine potential cumulative effects of PRSS28 deficiency across multiple pregnancy cycles, as subtle defects might compound over time.

• Embryo transfer experiments: Evaluate implantation efficiency through controlled embryo transfer studies, which might reveal subtle differences not apparent in natural mating scenarios.

• Cross-species embryo studies: Test whether PRSS28 might play roles in species-specific implantation barriers, given its initial hypothesized role in embryo hatching .

These experimental approaches could uncover conditional phenotypes that are not evident under optimal laboratory conditions and might better reflect the evolutionary significance of PRSS28.

What are the methodological challenges in isolating and studying uterine gland-specific proteins like PRSS28?

Studying gland-specific proteins like PRSS28 presents several methodological challenges:

• Cellular heterogeneity: Uterine tissue contains multiple cell types, making it difficult to isolate pure glandular epithelium for protein studies. Laser capture microdissection can help obtain enriched glandular populations.

• Temporal expression dynamics: PRSS28 expression is regulated by hormonal cycles and pregnancy status, requiring precise timing of tissue collection .

• Protein extraction efficiency: Secreted proteases may be difficult to extract efficiently from tissues. Optimized protein extraction buffers with appropriate protease inhibitors are essential.

• Enzymatic activity assessment: Measuring native protease activity requires specialized substrates and assay conditions that maintain protein conformation and activity.

• Antibody specificity: Developing specific antibodies against PRSS28 that don't cross-react with the 46% similar PRSS29 requires careful validation .

• In vitro models: Establishing primary cultures of mouse uterine glandular epithelium that maintain PRSS28 expression is technically challenging but valuable for mechanistic studies.

Addressing these challenges requires a combination of advanced molecular techniques, careful experimental design, and appropriate controls to ensure reliable and reproducible results.

What qRT-PCR protocols are recommended for analyzing PRSS28 expression?

For reliable quantification of PRSS28 expression by qRT-PCR, follow this detailed protocol:

• RNA extraction:

  • Extract total RNA from uterine tissues using TRIzol reagent

  • Ensure RNA integrity through gel electrophoresis or Bioanalyzer analysis

• cDNA synthesis:

  • Use 1 μg of total RNA for cDNA synthesis using a High-Capacity cDNA Reverse Transcription Kit

  • Dilute the resulting cDNA ten-fold with nuclease-free water

• qRT-PCR setup:

  • Prepare 10 μL reaction mixtures containing:

    • SYBR Green Supermix

    • Gene-specific primers (250 nM each)

    • Diluted cDNA template

  • Run samples in technical triplicates to ensure reproducibility

• Primers and controls:

  • Design PRSS28-specific primers that span exon-exon junctions to avoid genomic DNA amplification

  • Include appropriate reference genes (18S RNA is recommended) for normalization

  • Include no-template and no-RT controls to detect contamination

• Data analysis:

  • Use the delta-delta Ct method for relative quantification

  • Normalize to 18S RNA or other stable reference genes

  • Apply appropriate statistical tests (e.g., one-way ANOVA followed by Tukey's post hoc test) to compare expression differences between experimental groups

This protocol ensures accurate quantification of PRSS28 transcript levels across different experimental conditions and genotypes.

How can I quantify and analyze uterine gland development in PRSS28 studies?

For comprehensive analysis of uterine gland development, implement the following quantitative approach:

• Tissue preparation and sectioning:

  • Collect uteri at defined estrous cycle stages (preferably proestrus)

  • Process tissues consistently using OCT embedding and cryosectioning at 6 μm thickness

• Immunostaining protocol:

  • Use dual immunofluorescence with antibodies against:

    • Cytokeratin 8 (epithelial marker)

    • FOXA2 (gland-specific marker)

  • Include nuclear counterstaining with Hoechst 33342

• Quantification strategy:

  • Examine multiple non-sequential sections (40 recommended) to avoid counting the same glands twice

  • Count FOXA2-positive glands in each section

  • Calculate the average number of glands per section for each animal

• Morphometric analysis:

  • Measure gland diameter, depth, and branching using image analysis software

  • Assess the distribution of glands throughout the endometrium (superficial vs. deep)

• Statistical analysis:

  • Compare gland numbers between genotypes using Student's t-test or ANOVA

  • Present data as mean ± standard deviation with appropriate significance indicators

This comprehensive analysis provides quantitative assessment of gland development, allowing detection of subtle phenotypic differences that might not be apparent from qualitative observation alone.

What genotyping strategies are most effective for PRSS28 mutant mice?

Efficient genotyping of PRSS28 mutant mice requires a well-optimized PCR-based approach:

• DNA extraction:

  • For initial founder confirmation, use high-quality DNA purified with Gentra Puregene Mouse Tail Kit

  • For routine genotyping, employ a rapid KOH-EDTA digestion method on tail snips

• PCR primer design:

  • Design primers that flank the deletion site to distinguish between wild-type and mutant alleles

  • For PRSS28 deletion, primers should amplify across the ~876 bp deletion

  • Include internal primers within the deleted region as positive controls for wild-type alleles

• PCR conditions:

  • Optimize annealing temperatures and extension times based on the expected product sizes

  • Use a high-fidelity polymerase for initial confirmation of mutations

  • Standard Taq polymerase is sufficient for routine genotyping

• Product visualization and validation:

  • Separate PCR products on agarose gels to distinguish between wild-type, heterozygous, and homozygous animals

  • Confirm mutations by Sanger sequencing of PCR products

• Controls and validation:

  • Always include known wild-type, heterozygous, and homozygous samples as controls

  • Periodically sequence samples to confirm genotyping accuracy

This strategy ensures reliable identification of all genotypes and is essential for maintaining the integrity of experimental cohorts in PRSS28 research.