PSMC3IP Antibody

What is PSMC3IP and why is it significant in cellular biology?

PSMC3IP, also known as HOP2, GT198, HUMGT198A, or TBPIP, is a protein that primarily functions in meiotic recombination. It forms a heterodimer with MND1 that promotes RAD51 and DMC1-dependent D-loop formation during meiosis in yeast and mammalian organisms . Beyond its canonical role in meiosis, recent research has revealed its important functions in mitotic cells, particularly in DNA damage response pathways and homology-directed repair . Understanding PSMC3IP is crucial because it has implications for PARP inhibitor sensitivity, DNA repair, and potentially cancer biology.

What applications can PSMC3IP antibodies be used for?

PSMC3IP antibodies can be utilized in multiple experimental applications:

These applications enable researchers to detect, quantify, and localize PSMC3IP in various experimental systems . The antibody has demonstrated reactivity with human, mouse, and rat samples, making it versatile for comparative studies across species .

What is the optimal protocol for immunohistochemical detection of PSMC3IP in testicular tissue?

For optimal immunohistochemical detection of PSMC3IP in testicular tissue, use the following protocol:

• Fix tissue sections appropriately (4% paraformaldehyde recommended)

• Perform antigen retrieval with TE buffer pH 9.0 (alternatively, citrate buffer pH 6.0 may be used)

• Block with appropriate serum (5% normal goat serum in PBS)

• Apply primary PSMC3IP antibody at 1:400-1:1600 dilution

• Incubate overnight at 4°C

• Apply secondary antibody and develop using standard protocols

This protocol has been validated for mouse and rat testis tissue. The antibody has been shown to yield specific staining in these tissues, particularly in spermatocytes where PSMC3IP plays a crucial role in meiotic recombination .

How should PSMC3IP antibodies be stored and handled for optimal performance?

PSMC3IP antibodies should be stored at -20°C where they remain stable for one year after shipment. The antibody is typically supplied in PBS with 0.02% sodium azide and 50% glycerol at pH 7.3 . Aliquoting is unnecessary for -20°C storage, which simplifies lab handling. Some smaller quantities (20μl sizes) contain 0.1% BSA .

For optimal performance, avoid repeated freeze-thaw cycles and keep the antibody on ice while in use. When diluting for applications, use fresh buffers and prepare working solutions on the day of the experiment. It is advisable to centrifuge the antibody briefly before opening to collect all liquid at the bottom of the vial.

How does PSMC3IP function in DNA repair pathways and how can antibodies help investigate this?

PSMC3IP plays a crucial role in homology-directed DNA repair through its interaction with RAD51. The PSMC3IP-MND1 heterodimer promotes RAD51-dependent D-loop formation, a critical step in homologous recombination . In cells depleted of PSMC3IP, toxic RAD51 foci accumulate in response to DNA damage, indicating impaired homology-directed repair .

Researchers can investigate this function using PSMC3IP antibodies through:

• Co-immunoprecipitation experiments to identify protein interactions with DNA repair factors

• Immunofluorescence to monitor PSMC3IP localization to sites of DNA damage

• Chromatin immunoprecipitation (ChIP) to assess PSMC3IP binding to damaged DNA regions

• Western blotting to examine PSMC3IP expression levels in response to DNA-damaging agents

These approaches can help elucidate how PSMC3IP coordinates with other proteins in DNA repair complexes and how its dysfunction may contribute to genomic instability.

What is the relationship between PSMC3IP and PARP inhibitor sensitivity in cancer research?

Recent research has uncovered that depletion of PSMC3IP causes sensitivity to clinical Poly (ADP-Ribose) Polymerase inhibitors (PARPi) in mitotic cells . This finding has significant implications for cancer research, particularly for understanding mechanisms of PARPi resistance and sensitivity.

The relationship between PSMC3IP and PARPi sensitivity is characterized by:

• PSMC3IP-depleted cells accumulate toxic RAD51 foci in response to DNA damage

• These cells show impaired homology-directed DNA repair

• The PSMC3IP p.Glu201del mutation (associated with ovarian dysgenesis) fails to reverse PARPi sensitivity

• Inhibition of RAD51 partially reverses the PARPi sensitivity phenotype in PSMC3IP-depleted cells

Researchers can use PSMC3IP antibodies in cell viability assays, immunofluorescence studies, and biochemical analyses to further investigate this relationship and potentially identify biomarkers for PARPi response in cancer patients.

How can PSMC3IP antibodies be used to study the PSMC3IP-MND1 heterodimer formation and function?

The PSMC3IP-MND1 heterodimer is crucial for promoting RAD51 and DMC1-dependent D-loop formation. To study this complex:

• Co-immunoprecipitation using PSMC3IP antibodies can pull down the heterodimer from cell lysates

• Proximity ligation assays can visualize the heterodimer formation in situ

• In vitro reconstitution of the complex followed by functional assays can assess the impact of mutations

• Quantitative immunofluorescence can measure co-localization of PSMC3IP and MND1 at sites of DNA damage

These approaches can help researchers understand how the heterodimer assembles, its subcellular localization, and how mutations in either protein affect complex formation and function. The antibody with catalog number 11339-1-AP has been validated for immunoprecipitation in Jurkat cells, making it suitable for such studies .

What are the considerations for validating PSMC3IP antibody specificity in knockout/knockdown systems?

Validating antibody specificity is crucial for reliable research results. For PSMC3IP antibodies:

• Use CRISPR/Cas9-mediated knockout of PSMC3IP as a negative control

• Alternatively, utilize siRNA or shRNA knockdown systems

• Include recombinant PSMC3IP protein as a positive control

• Perform peptide competition assays to confirm binding specificity

Published literature indicates that PSMC3IP knockdown/knockout systems have been developed and can be used for validation . The sgRNA sequence "GTAGGTTTCCGAACACGTCCT" has been utilized for targeting PSMC3IP in cell lines, and TIDE analysis can confirm target modifications . This validation is particularly important given that multiple antibodies from different providers target PSMC3IP, with varying levels of validation and applications .

What are common troubleshooting strategies for weak or non-specific signals when using PSMC3IP antibodies?

When encountering weak or non-specific signals:

• Adjust antibody concentration: Test a range of dilutions around the recommended 1:500-1:2000 for Western blot

• Optimize antigen retrieval: For IHC, compare TE buffer pH 9.0 with citrate buffer pH 6.0

• Modify blocking conditions: Increase blocking time or change blocking agent

• Adjust incubation times and temperatures: Extend primary antibody incubation to overnight at 4°C

• Use fresh reagents: Older secondary antibodies may lose activity

It's important to note that PSMC3IP has an observed molecular weight range of 24-29 kDa, which may appear as multiple bands in some tissues or cell types . Understanding the expected banding pattern will help distinguish between specific signals and non-specific binding.

How can PSMC3IP antibodies be used to investigate meiotic versus mitotic functions of PSMC3IP?

PSMC3IP has distinct functions in meiotic and mitotic cells. To investigate these dual roles:

• Compare PSMC3IP expression and localization in meiotic tissues (testis/ovary) versus mitotic cell lines

• Use synchronized cell populations to examine cell-cycle dependent changes in PSMC3IP localization

• Perform co-immunoprecipitation in both cell types to identify differential protein partners

• Combine with functional assays for homologous recombination in both contexts

Recent research has revealed that PSMC3IP-MND1 has functions beyond its canonical role in meiosis, including roles in mitotic cells that don't use alternative lengthening of telomeres (ALT) . This dual functionality makes PSMC3IP an interesting protein to study in comparative contexts.

What considerations should be made when designing experiments to study PSMC3IP mutations using antibodies?

When studying PSMC3IP mutations (such as the p.Glu201del associated with ovarian dysgenesis):

• Verify antibody epitope location relative to the mutation site

• Consider whether the mutation affects protein expression, stability, localization, or function

• Include appropriate wild-type controls in parallel experiments

• Design experiments to specifically assess the functional impact of the mutation

The p.Glu201del mutation has been shown to act as a dominant negative, further sensitizing cells to PARPi . When studying such mutations, researchers should carefully consider whether the antibody's epitope might be affected by the mutation itself, potentially leading to altered antibody recognition.

How does PSMC3IP contribute to alternative lengthening of telomeres (ALT) and how can antibodies help study this process?

PSMC3IP and MND1 contribute to alternative lengthening of telomeres (ALT) . The PSMC3IP-MND1 heterodimer promotes telomere clustering and RAD51-mediated recombination between distant telomeres. Researchers can investigate this process using:

• ChIP assays to assess PSMC3IP binding to telomeric regions

• Immunofluorescence combined with telomere FISH to visualize PSMC3IP at telomeres

• Proximity ligation assays to detect PSMC3IP interactions with telomere-binding proteins

• Co-immunoprecipitation to identify telomere-specific interaction partners

Understanding PSMC3IP's role in ALT may have implications for cancer biology, as approximately 10-15% of cancers use ALT for telomere maintenance rather than telomerase.

What is the significance of PSMC3IP in cancer research and how can antibodies facilitate these studies?

PSMC3IP has emerged as a significant factor in cancer research:

• Its role in determining PARP inhibitor sensitivity makes it relevant for cancer therapy research

• Mutations or dysregulation might contribute to genomic instability, a hallmark of cancer

• Its function in DNA repair pathways suggests potential roles in tumor suppression

• The relationship with BRCA1/BRCA2 implies relevance to hereditary cancer syndromes

PSMC3IP antibodies can facilitate cancer research through:

• Tissue microarray analysis to assess expression across tumor types

• Patient-derived xenograft studies to correlate expression with treatment response

• Mechanistic studies to understand how PSMC3IP affects therapy resistance

• Biomarker development for predicting response to DNA-damaging therapies

The relationship between PSMC3IP and established cancer-related factors like BRCA1 and TP53BP1 makes it an intriguing target for ongoing investigation .

How can multiplex immunofluorescence approaches combining PSMC3IP with DNA repair proteins provide insights into complex repair mechanisms?

Multiplex immunofluorescence combining PSMC3IP with other DNA repair proteins can reveal:

• Spatial and temporal relationships between PSMC3IP and other repair factors

• Co-localization patterns at sites of DNA damage

• Cell-to-cell variability in repair complex formation

• Changes in protein associations under different types of DNA damage

A recommended approach includes:

• Primary antibodies from different host species (PSMC3IP rabbit polyclonal with mouse anti-RAD51)

• Use of spectrally distinct fluorophores

• Sequential staining protocols if antibody cross-reactivity is a concern

• Analysis with confocal microscopy and quantitative image analysis

The IF/ICC application of PSMC3IP antibody at 1:200-1:800 dilution has been validated for such studies , making it suitable for multiplex approaches.

What future directions in PSMC3IP research might benefit from antibody-based techniques?

Several emerging research areas could benefit from PSMC3IP antibody applications:

• Single-cell analysis to understand cell-to-cell variation in PSMC3IP expression and localization

• Structural studies combining antibody mapping with cryo-EM to determine protein complex architecture

• Development of proximity-dependent biotinylation (BioID) approaches to identify novel interaction partners

• In vivo imaging using fluorescently labeled antibody fragments to track PSMC3IP dynamics

The continued refinement of antibody-based techniques will help elucidate PSMC3IP's complex roles in both meiotic and mitotic cells, potentially leading to new insights into fundamental cellular processes and disease mechanisms.

How might understanding PSMC3IP function contribute to therapeutic development for conditions involving DNA repair deficiencies?

PSMC3IP's role in DNA repair and PARP inhibitor sensitivity suggests several therapeutic implications:

• PSMC3IP status might serve as a biomarker for PARP inhibitor response in cancer patients

• Targeting the PSMC3IP-MND1 complex might sensitize resistant tumors to DNA-damaging therapies

• Understanding PSMC3IP function could identify synthetic lethal interactions for cancer treatment

• PSMC3IP mutations may contribute to fertility disorders that could benefit from targeted interventions