PSMD12 Antibody

What is PSMD12 and what is its biological significance?

PSMD12 (proteasome 26S subunit, non-ATPase 12, also known as RPN5) is a non-ATPase subunit of the 19S regulatory complex of the 26S proteasome. It plays a crucial role in protein degradation pathways that regulate the cell cycle, DNA damage repair, and apoptosis through the removal of misfolded or damaged proteins. Initially discovered in fission yeast, PSMD12 forms part of the 19S regulatory lid complex that recognizes ubiquitinated substrates and facilitates their deubiquitination before degradation by the 20S core particle . Recent studies have identified that PSMD12 haploinsufficiency is associated with both neurodevelopmental disorders (Stankiewicz-Isidor syndrome) and proteasome-associated autoinflammatory syndrome (PRAAS), highlighting its essential role in both neurological development and immune regulation .

How do PSMD12 antibodies differ in terms of species reactivity and applications?

PSMD12 antibodies typically show cross-reactivity across multiple species, making them versatile tools for comparative studies. Commercial antibodies like the polyclonal antibody 11412-1-AP demonstrate reactivity with human, mouse, and rat PSMD12 proteins . The specificity and cross-reactivity of these antibodies enable their use in various experimental applications including Western blot (WB), immunohistochemistry (IHC), and ELISA .

These antibodies have been validated in multiple tissues and cell lines, with the 11412-1-AP antibody showing positive Western blot detection in MCF-7 cells, mouse lung tissue, and rat lung tissue, and positive IHC detection in human gliomas tissue .

What are the optimal conditions for using PSMD12 antibodies in Western blot applications?

When using PSMD12 antibodies for Western blot applications, researchers should consider the following methodological approach:

• Sample preparation: Prepare cell or tissue lysates using appropriate lysis buffers containing protease inhibitors. For example, use ice-cold cell lysis buffer (20 mM Tris HCl [pH 7.4], 150 mM NaCl, 0.5% Nonidet P40, 10% glycerol with protease and phosphatase inhibitors) for 15 minutes followed by centrifugation at 13,000 g at 4°C for 15 minutes .

• Protein quantification and loading: Quantify protein content and load 10-20 μg of total protein per well .

• Gel electrophoresis and transfer: Separate proteins using 8% SDS-PAGE gels and transfer to PVDF membranes .

• Antibody dilution: Use PSMD12 antibodies at optimal dilutions - 1:500 to 1:3000 for 11412-1-AP or 1:500 to 1:2000 for A6708 .

• Detection system: Employ enhanced chemiluminescence-based approaches such as SuperSignal West Pico chemiluminescent substrate .

• Expected band size: Look for the PSMD12 protein band at approximately 50-55 kDa, which corresponds to the calculated molecular weight of 53 kDa (456 amino acids) .

How should PSMD12 antibodies be optimized for immunohistochemistry applications?

For immunohistochemistry applications with PSMD12 antibodies, researchers should follow these methodological guidelines:

• Tissue preparation: Use formalin-fixed, paraffin-embedded tissue sections or frozen sections depending on the experimental design.

• Antigen retrieval: Perform antigen retrieval with TE buffer pH 9.0 as suggested for the 11412-1-AP antibody. Alternatively, citrate buffer pH 6.0 can be used .

• Antibody dilution: Use dilutions ranging from 1:50 to 1:500 for IHC applications with the 11412-1-AP antibody .

• Controls: Include appropriate positive and negative controls. Human gliomas tissue has been validated as a positive control for PSMD12 IHC .

• Titration: It is recommended to titrate the antibody in each testing system to obtain optimal results, as the optimal dilution may be sample-dependent .

What are common challenges when working with PSMD12 antibodies and how can they be addressed?

Researchers may encounter several challenges when working with PSMD12 antibodies:

• Non-specific binding: To reduce background and non-specific binding:

  • Optimize blocking conditions using 5% non-fat dry milk or bovine serum albumin (BSA)

  • Increase washing steps between antibody incubations

  • Titrate primary antibody concentrations to find the optimal signal-to-noise ratio

• Weak signal detection: For enhanced sensitivity:

  • Increase antibody concentration within the recommended range (1:500-1:3000)

  • Extend primary antibody incubation time (overnight at 4°C)

  • Use more sensitive detection systems or signal amplification methods

• Inconsistent results between experiments: To improve reproducibility:

  • Maintain consistent protocol parameters including sample preparation, buffer composition, and incubation times

  • Aliquot antibodies to avoid freeze-thaw cycles, as recommended for the 11412-1-AP antibody which should be stored at -20°C

  • Use the same lot number of antibody when possible for sequential experiments

How can researchers verify PSMD12 antibody specificity in their experimental systems?

Verifying antibody specificity is crucial for reliable research outcomes. For PSMD12 antibodies, consider these methodological approaches:

• PSMD12 knockdown/knockout controls: Generate PSMD12 knockdown cell lines using shRNA as described in . Four different shRNA sequences can be used:

  • shPSMD12-1: CCGGCCTAGCTGTGAAGGATTACATCTCGAGATGTAATCCTTCACAGCTAGGTTTTTG

  • shPSMD12-2: CCGGCCGAATAAGTGGTGACAAGAACTCGAGTTCTTGTCACCACTTATTCGGTTTTTG

  • shPSMD12-3: CCGGCCTTCCTATCAAACTTCGATTCTCGAGAATCGAAGTTTGATAGGAAGGTTTTTG

  • shPSMD12-4: CCGGGCCAAGTATTATACTCGGATACTCGAGTATCCGAGTATAATACTTGGCTTTTTG

  These knockdown controls should show reduced band intensity compared to wild-type cells .

• Comparative analysis with multiple antibodies: Use different antibodies targeting distinct epitopes of PSMD12 to confirm consistent detection patterns.

• Recombinant protein controls: Use purified recombinant PSMD12 protein as a positive control. The immunogen for the A6708 antibody corresponds to amino acids 197-456 of human PSMD12 .

How can PSMD12 antibodies be used to investigate proteasome dysfunction in disease models?

PSMD12 antibodies can be valuable tools for investigating proteasome dysfunction in various disease contexts:

• Assessment of proteasome assembly: Native gel electrophoresis combined with Western blotting using PSMD12 antibodies can reveal defects in 26S proteasome assembly, as demonstrated in PSMD12-knockdown cell lines .

• Protein-protein interaction studies: Immunoprecipitation using PSMD12 antibodies can evaluate interactions between PSMD12 and other 19S subunits, including both ATPase and non-ATPase components. This approach revealed reduced interactions of truncated PSMD12 with a set of 19S subunits in disease models .

• Ubiquitinated protein accumulation: Western blot analysis of K48 ubiquitin-modified proteins in patient samples compared to healthy controls can reveal consequences of impaired proteasome function resulting from PSMD12 mutations .

• Proteasome activity assays: Combined with PSMD12 antibodies for expression analysis, proteasome activity measurements can correlate PSMD12 levels with functional outcomes in disease models .

What is the significance of PSMD12 haploinsufficiency in neurodevelopmental and inflammatory disorders?

Recent research has uncovered the dual role of PSMD12 in both neurodevelopmental and inflammatory pathways:

• Stankiewicz-Isidor syndrome: PSMD12 haploinsufficiency is associated with a syndromic neurodevelopmental disorder characterized by brain abnormalities, dysmorphic features, ophthalmologic abnormalities, genital anomalies, and skeletal defects .

• Proteasome-associated autoinflammatory syndrome (PRAAS): A novel truncated variant in PSMD12 (c.865C>T, p.Arg289*) was identified in family members presenting with skin rash, congenital uveitis, and developmental delay. Functional studies in patient-derived cells showed:

  • Impaired proteasome function in peripheral blood mononuclear cells

  • Elevated interferon signals, especially in monocytes, as detected by single-cell RNA sequencing

  • Accumulation of K48 ubiquitin-modified proteins compared to healthy controls

• Experimental verification: Western blot analysis of lymphoblastoid cell lines from affected individuals with a PSMD12 nonsense mutation (p.R123X) demonstrated reduced PSMD12 protein expression compared to unaffected controls, confirming the functional impact of this mutation .

These findings establish PSMD12 as a bridge between inflammatory and neurodevelopmental phenotypes, expanding our understanding of proteasome dysfunction in human disease.

How can researchers design PSMD12 functional studies using both antibody-based and genetic approaches?

Comprehensive investigation of PSMD12 function can be achieved through integrated antibody-based and genetic approaches:

• Gene expression manipulation:

  • Generate PSMD12 knockdown cell lines using shRNA constructs in pLKO.1 plasmids, followed by puromycin selection (1.5 μg/ml for 5-7 days)

  • Verify knockdown efficiency through qPCR and Western blot analysis using PSMD12 antibodies

  • For mutation studies, clone wild-type PSMD12 from healthy control cDNA and introduce specific mutations through site-directed mutagenesis

• Patient-derived cell models:

  • Establish EBV-transformed lymphoblastoid cell lines from affected and unaffected family members

  • Culture cells in RPMI-1640 with 2 mM L-glutamine, 10% fetal bovine serum, and 1% v/v Penicillin-Streptomycin solution

  • Use appropriate lysis buffers (e.g., 50 mM Tris pH 7.5, 150 mM NaCl, 0.5% NP40, 2 mM OPT with protease and phosphatase inhibitors)

• Functional proteasome assays:

  • Measure three types of proteasome activities (chymotrypsin-like, trypsin-like, and caspase-like) in wild-type versus PSMD12-deficient cells

  • Use native gel electrophoresis to assess 26S proteasome assembly

  • Quantify accumulation of polyubiquitinated proteins as a readout of proteasome dysfunction

• Integrated multi-omics approaches:

  • Combine antibody-based detection of PSMD12 with transcriptomic or proteomic profiling

  • Perform single-cell RNA sequencing to identify cell-type-specific effects of PSMD12 deficiency, as demonstrated for monocytes with elevated interferon signatures

How might PSMD12 antibodies contribute to understanding broader proteasome biology in health and disease?

PSMD12 antibodies can be instrumental in exploring several emerging areas of proteasome research:

• Tissue-specific proteasome regulation: Using PSMD12 antibodies to compare expression and post-translational modifications across different tissues could reveal tissue-specific regulatory mechanisms. The validated reactivity in multiple tissues (MCF-7 cells, mouse and rat lung tissue, human gliomas) provides a foundation for such comparative studies .

• Differential proteasome complex assembly: Immunoprecipitation with PSMD12 antibodies followed by mass spectrometry could identify tissue-specific or condition-specific interaction partners, expanding our understanding of proteasome heterogeneity.

• Therapeutic targeting of the proteasome: PSMD12 antibodies can help evaluate the specificity and mechanism of action of novel proteasome-targeting compounds, potentially identifying selective modulators of specific proteasome subunits or assemblies.

• Biomarker development: Changes in PSMD12 expression or localization might serve as biomarkers for disease states characterized by proteasome dysfunction. The established methods for PSMD12 detection in patient samples provide a methodological framework for biomarker studies .