PTN Antibody, HRP conjugated

What is Pleiotrophin and why is it significant in research?

Pleiotrophin (PTN) is an extracellular matrix-associated growth factor and chemokine expressed in both mesodermal and ectodermal cells. Its significance stems from its multifunctional role in regulating cellular signaling pathways, particularly through phosphorylation mechanisms. PTN has been demonstrated to regulate tyrosine phosphorylation of β-adducin through the PTN/receptor protein tyrosine phosphatase (RPTP)β/ζ signaling pathway . Research indicates that PTN plays critical roles in development, particularly in tissues such as the mammary gland, where it appears to maintain epithelial cells in a progenitor phenotype, thereby influencing tissue maturation . Additionally, PTN expression has been documented during odontogenesis, highlighting its importance in developmental processes .

What are the standard applications for PTN antibodies in research?

PTN antibodies are utilized across multiple experimental platforms with varied protocols:

• Western Blot (WB): PTN antibodies detect PTN protein at approximately 19 kDa. Typical protocols employ the antibody at 0.5 μg/mL concentration overnight at 4°C, followed by incubation with a secondary antibody such as goat anti-rabbit IgG-HRP at 1:5000 dilution .

• Immunohistochemistry (IHC): PTN antibodies are effectively used at concentrations of 1:50 to 1:100 dilution, followed by appropriate HRP-conjugated secondary antibodies and visualization using 3–3′ tetrachloride diaminobenzidine (DAB) oxidization .

• Cell-based assays: PTN antibodies are employed in migration and invasion assays using real-time monitoring electric impedance to study PTN activity in cellular processes .

How should PTN antibodies be stored and handled to maintain optimal activity?

For maximum shelf life and experimental reliability, PTN antibodies require specific storage conditions. Lyophilized PTN antibodies should be stored at -20°C for up to one year from the date of receipt. After reconstitution, they can be stored at 4°C for one month or aliquoted and stored frozen at -20°C for up to six months . It is crucial to avoid repeated freeze-thaw cycles as they can significantly diminish antibody activity and specificity. When handling these antibodies for experiments, allowing them to equilibrate to room temperature before opening the vial is recommended to prevent condensation which could affect antibody stability.

What are the recommended positive control tissues or cell lines for validating PTN antibody performance?

Based on the research literature, several positive controls have been validated for PTN antibody experiments:

When validating a new lot of PTN antibody, researchers should include at least one of these positive controls to confirm antibody specificity and sensitivity.

How can researchers optimize PTN antibody protocols for detecting phosphorylated forms of downstream targets?

The detection of phosphorylated downstream targets of PTN signaling requires carefully optimized protocols. For detecting phosphorylated β-adducin (at serines 713 and 726), which is regulated by PTN signaling, researchers should implement the following optimizations:

• Sample preparation: Treat cells with PTN (50 ng/ml) for specific time intervals (5, 20, and 60 minutes show progressive increases in phosphorylation) to capture the dynamic phosphorylation events .

• Buffer considerations: Use phosphatase inhibitors in all lysis and wash buffers to preserve the phosphorylation state of targets.

• Antibody selection: Utilize specific anti-phosphoserine antibodies (such as anti-phosphoserine 713 and 726 β-adducin antibodies) for precise detection of phosphorylated residues .

• Visualization techniques: For subcellular localization studies, combine confocal microscopy with fluorescent-tagged antibodies against phosphorylated targets, plus nuclear staining (DAPI) and cytoskeletal markers (phalloidin) to precisely track the redistribution of phosphorylated proteins following PTN stimulation .

Research demonstrates that PTN stimulation induces a time-dependent increase in phosphorylation of serines 713 and 726 in β-adducin, with significant increases observable within 5 minutes, further increases at 20 minutes, and sustained levels through 60 minutes .

What methodological approaches should be employed to study PTN's effects on cellular redistribution of proteins?

To effectively study PTN-induced cellular redistribution of proteins such as phosphorylated β-adducin, researchers should implement a multi-faceted approach:

• Confocal microscopy with immunofluorescence: This technique provides high-resolution visualization of protein redistribution. Research has demonstrated that in non-PTN-stimulated, nonconfluent cells, phosphoserine 713 and 726 β-adducin is primarily localized in nuclei. Following PTN stimulation, there is a marked increase in cytosolic localization, appearing in small endocytic vesicles .

• Cell density considerations: The response to PTN varies significantly between confluent and non-confluent cells. In confluent cells, phosphoserine β-adducin localizes to regions of cell-cell contact before PTN stimulation, but redistributes to nuclei and diffusely throughout the cytoplasm after PTN stimulation .

• Time-course analysis: Sequential sampling (5, 20, 60 minutes) post-PTN treatment enables researchers to track the dynamic nature of protein redistribution.

• Co-localization studies: Combining anti-phosphoserine antibodies with markers for subcellular compartments helps identify the precise destination of redistributed proteins following PTN stimulation .

How can researchers distinguish between PTN-specific effects and non-specific binding when using PTN antibodies in complex tissue samples?

Distinguishing specific from non-specific signals requires rigorous experimental controls:

• Negative controls: Always include sections treated with isotype-matched control antibodies or blocking buffer (e.g., 10% BSA in 1× PBS) without primary antibody .

• Antibody titration: Perform systematic dilution series (e.g., 1:50, 1:100, 1:200) to identify the optimal concentration that maximizes specific signal while minimizing background .

• Complementary approaches: Validate antibody-based findings using orthogonal methods:

  • mRNA detection via in situ hybridization or qRT-PCR

  • Functional assays with PTN blocking antibodies and recombinant proteins

  • Knockout/knockdown controls where possible

• Tissue-specific validation: Include known positive and negative control tissues in each experimental run. For instance, research has shown glioma tissue exhibits positive PTN staining, making it a reliable positive control for human samples .

What are the best experimental designs to evaluate the role of PTN in regulating cell migration and invasion?

Research into PTN's effects on cell migration and invasion benefits from real-time monitoring approaches:

• Real-time electric impedance monitoring: This technique allows continuous measurement of cell migration and invasion. Research with mammary epithelial cells (MECs) has shown that treatment with anti-PTN antibody inhibits migration, while recombinant PTN can restore migration to control levels after initial inhibition .

• Comparative stimulation experiments: Design experiments that include:

  • Treatment with PTN blocking antibody alone

  • Addition of recombinant PTN

  • Combined treatment with blocking antibody and recombinant PTN

  • Control treatments with other growth factors (e.g., bFGF) to confirm cell responsiveness

• Three-dimensional culture systems: Growing cells in 3D matrices such as Matrigel provides more physiologically relevant conditions for assessing invasion and maintains signaling cues for cellular organization and differentiation .

• Temporal analysis: Monitor cellular responses over extended periods (12+ hours) as PTN effects may show biphasic patterns, with initial inhibition followed by stimulation of migration .

What strategies should researchers employ when analyzing PTN expression patterns across developmental stages?

Comprehensive analysis of PTN expression during development requires a multi-modal approach:

• Tissue-specific sampling: Collect samples at defined developmental stages. Research has documented PTN expression during odontogenesis and in the developing mammary gland .

• Quantitative expression analysis: Implement qRT-PCR with validated primers:

  • PTN Forward: TGGAGAATGGCAGTGGAGTGTGT

  • PTN Reverse: TGGTACTTGCACTCAGCTCCAAACT

• Spatial expression mapping: Combine whole mount staining with immunohistochemistry and in situ hybridization to create comprehensive expression maps.

• Functional modulation: Assess the effects of growth factors on PTN expression. Research has shown that treatment with BMP2 and BMP7 significantly increases PTN transcript levels, while BMP4 treatment decreases PTN expression .

What are the optimal protocols for using PTN antibodies in Western blot applications?

For optimal Western blot results with PTN antibodies, researchers should follow these validated protocols:

• Sample preparation: Prepare whole cell lysates or tissue homogenates in appropriate lysis buffer containing protease inhibitors. For PTN detection, 30 μg of protein per lane is recommended under reducing conditions .

• Gel electrophoresis parameters:

  • 13% SDS-PAGE gel

  • Run at 80V (stacking gel)/120V (resolving gel) for approximately 2 hours

• Transfer conditions:

  • Transfer to nitrocellulose membrane at 150 mA for 50-90 minutes

  • Block membrane with 5% non-fat milk in TBS for 1.5 hours at room temperature

• Antibody incubation:

  • Primary antibody: 0.5 μg/mL rabbit anti-PTN antibody overnight at 4°C

  • Wash with TBS-0.1%Tween 3 times (5 minutes each)

  • Secondary antibody: goat anti-rabbit IgG-HRP at 1:5000 dilution for 1.5 hours at room temperature

• Detection:

  • Develop using ECL Plus Western Blotting Substrate

  • Expected band for PTN is approximately 19 kDa

How should researchers design experiments to study time-dependent effects of PTN on cellular processes?

Time-dependent studies of PTN require careful experimental design:

• Time point selection: Based on published research, key time points for capturing PTN-induced phosphorylation events are 5, 20, and 60 minutes post-stimulation . For longer-term effects such as migration and invasion, measurements at 6, 12, and 24 hours may be more appropriate .

• PTN concentration standardization: Use 50 ng/ml of PTN for stimulation experiments, as this concentration has been validated in multiple studies .

• Control conditions: Maintain parallel non-stimulated controls for each time point to account for any time-dependent changes in baseline cellular processes.

• Multiple endpoint measurements: Combine protein quantification (Western blot) with functional assays and microscopy to correlate biochemical changes with functional outcomes.

• Data normalization: For Western blot analysis of time-dependent effects, normalize phosphoprotein signals to total protein levels and to housekeeping controls (e.g., β-actin) .

What quality control measures should be implemented when using PTN antibodies across different experimental platforms?

Comprehensive quality control measures ensure reliable and reproducible results:

• Lot-to-lot validation: For each new antibody lot, perform validation on known positive controls (U251 cells, brain tissue) to confirm expected detection patterns .

• Cross-platform verification: When using the same antibody across different applications (WB, IHC), verify specificity in each platform independently.

• Antibody specificity controls:

  • Peptide competition assays to confirm binding specificity

  • Isotype controls to identify non-specific binding

  • Secondary antibody-only controls to detect background signal

• Sample preparation consistency: Standardize fixation methods for IHC (formaldehyde fixation followed by paraffin embedding) and lysate preparation for Western blot to minimize technical variability .

• Reproducibility assessment: Perform technical replicates (minimum of three) and biological replicates (different samples) to ensure consistent results.

How can researchers address weak or absent signals when using PTN antibodies in IHC applications?

When encountering weak or absent signals in IHC with PTN antibodies, consider these troubleshooting steps:

• Antigen retrieval optimization: Heat-mediated antigen retrieval in EDTA buffer (pH 8.0) has been successfully used for PTN detection . If signals remain weak, compare multiple retrieval methods (citrate buffer, Tris-EDTA, enzymatic retrieval).

• Antibody concentration adjustment: If using the recommended 1:50 or 1:100 dilutions yields weak signals, titrate to higher concentrations while monitoring background levels .

• Detection system amplification: Consider using polymer-based detection systems or tyramide signal amplification to enhance sensitivity.

• Fixation assessment: Overfixation can mask epitopes. If possible, test samples with different fixation durations.

• Tissue-specific considerations: PTN expression varies by tissue. The expression profile indicates high PTN levels in spinal cord, suggesting it should work well for IHC in this tissue .

• Incubation conditions: Extend primary antibody incubation time (24-48 hours at 4°C) for challenging tissues.

What approaches should researchers take when investigating conflicting results between PTN antibody detection and functional outcomes?

Conflicting results between antibody detection and functional outcomes require systematic investigation:

• Mechanistic validation: Use recombinant PTN protein and PTN blocking antibodies in parallel to confirm that observed cellular responses are PTN-specific. Research has shown that while PTN blocking antibody inhibits mammary epithelial cell migration, stimulation with recombinant PTN protein can restore migration capacity .

• Receptor analysis: Measure expression levels of PTN receptors (e.g., ALK) using qRT-PCR to determine if cellular responsiveness correlates with receptor expression .

• Signaling pathway examination: Investigate the activation status of downstream signaling components in the PTN pathway to determine if functional effects correlate with pathway activation.

• Cell-type specificity assessment: Different cell types may respond differently to PTN. For example, PTN affects migration in mammary epithelial cells but does not impact their proliferation index .

• Temporal considerations: Ensure that protein detection and functional measurements are appropriately time-matched, as PTN effects may show different kinetics across different cellular processes.

How can researchers effectively combine PTN antibody-based detection with gene expression analysis for comprehensive pathway studies?

Integrating protein detection with gene expression analysis provides more complete pathway characterization:

• Co-extraction protocols: Implement protocols that allow simultaneous extraction of protein and RNA from the same sample for direct correlation between protein levels and gene expression.

• Multiplex approaches: Combine immunofluorescence with RNA in situ hybridization on the same tissue section to correlate protein localization with mRNA expression at the cellular level.

• qRT-PCR primer design: Utilize validated primers for PTN and related pathway components:

  • PTN: Forward (TGGAGAATGGCAGTGGAGTGTGT), Reverse (TGGTACTTGCACTCAGCTCCAAACT)

  • ALK: Forward (GGACGGGACACAGCTCCATG), Reverse (GCACTCCAGACCATATCGACTGCG)

  • Other pathway markers: CD10, CD29, CD49f, SCA-1

• Pathway validation: Confirm findings using complementary approaches such as reporter assays or phosphoprotein arrays to validate pathway activation status.

• Bioinformatic integration: Apply computational approaches to integrate protein detection data with gene expression profiles to identify regulatory networks and feedback mechanisms.

What emerging applications of PTN antibodies should researchers consider exploring?

The evolving landscape of PTN research points to several promising research directions:

• Single-cell analysis: Applying PTN antibodies in single-cell protein profiling to understand cellular heterogeneity in PTN signaling responses.

• Developmental biology applications: Further investigation of PTN's role in tissue development, building on findings in mammary gland development and odontogenesis .

• Therapeutic targeting: Exploration of blocking PTN signaling as a potential therapeutic approach, given its role in maintaining cells in a progenitor state and promoting migration and invasion .

• Multiplexed imaging: Combining PTN detection with other pathway markers using multiplexed immunofluorescence to map signaling networks at the tissue level.

• Cross-talk investigations: Examining interactions between PTN signaling and other pathways, such as BMP signaling, which has been shown to modulate PTN expression .