RAB11B Antibody

What is RAB11B and what cellular functions does it regulate?

RAB11B belongs to the small GTPase superfamily and Rab family. It functions as a key regulator of intracellular membrane trafficking, cycling between inactive GDP-bound and active GTP-bound forms that recruit downstream effectors responsible for vesicle formation, movement, tethering, and fusion . RAB11B plays diverse roles including:

• Endocytic recycling of transmembrane proteins including CFTR, ENaC, and voltage-dependent calcium channels

• Regulation of constitutive and regulated secretion, including insulin granule exocytosis

• Melanosome transport and release from melanocytes

• V-ATPase intracellular transport in response to extracellular acidosis

• Ciliogenesis initiation through formation of ciliary targeting complexes

• Mitotic spindle function in intestinal epithelial cells

• Mitochondrial integrity and function in gut epithelial cells

Recent research has revealed RAB11B's role as a "GTP-dependent switch between regulated and constitutive secretory pathways" in neuronal and neuroendocrine cells, but not in non-neuronal cells .

RAB11A and RAB11B are two closely related isoforms of the RAB11 subfamily with approximately 90% sequence identity , but they exhibit distinct functions and expression patterns:

• Expression differences: RAB11B is enriched in brain tissue, while RAB11A has a broader tissue distribution .

• Functional differences: When tested in PC12 cells, RAB11B had stronger effects on Ca²⁺-induced exocytosis compared to RAB11A .

• Protein interdependence: Downregulation of RAB11B leads to reduction in RAB11A protein levels by approximately 28.1%, while reduction of RAB11A decreases RAB11B levels by about 42.1% .

• Cellular localization: Both proteins show similar localization patterns when expressed as GFP fusion proteins, but RAB11B shows better colocalization with mitochondrial components compared to RAB11A .

• Interaction with other proteins: Studies suggest RAB11B and RAB11A may have different binding affinities and specificities for effector proteins .

When designing experiments, researchers should carefully choose isoform-specific antibodies to avoid cross-reactivity .

What sample types can be analyzed with RAB11B antibodies?

RAB11B antibodies have demonstrated reactivity with multiple sample types:

Human samples:

• Cell lines: HEK-293/293T, HeLa, Jurkat, SH-SY5Y, A549

• Tissues: Brain, testis, lung, placenta, stomach

Mouse samples:

• Cell lines: NIH/3T3, RAW 264.7

• Tissues: Brain, testis

Rat samples:

• Cell lines: PC-12, C6

• Tissues: Brain

For optimal detection in different tissues, various antigen retrieval methods may be required. For IHC applications, TE buffer (pH 9.0) is suggested, with citrate buffer (pH 6.0) as an alternative . When working with new sample types not listed above, validation experiments are essential.

How can I design robust validation experiments for RAB11B antibodies?

Validation of RAB11B antibodies requires multiple approaches to ensure specificity and reliability:

• Molecular weight verification: Confirm the detection of RAB11B at its expected molecular weight of 24 kDa by Western blot .

• Knockout/knockdown controls:

  • Generate siRNA-mediated knockdown of RAB11B (consider that RAB11B knockdown may affect RAB11A levels by ~28%) .

  • Use CRISPR-Cas9 knockout models, such as the Rab11b⁻/⁻ mice described in literature .

• Cross-reactivity assessment:

  • Test the antibody against purified recombinant RAB11B, RAB11A, and RAB25 proteins.

  • Use overexpression systems with tagged versions (GFP-RAB11B, GFP-RAB11A) to compare specificity .

• Tissue distribution analysis:

  • Compare antibody staining patterns with known RAB11B mRNA expression profiles.

  • Use multiple antibodies targeting different epitopes of RAB11B to confirm specificity.

• Functional validation:

  • Verify that the antibody can immunoprecipitate RAB11B complexes that contain known interaction partners .

  • Confirm antibody recognition of both GDP-bound and GTP-bound forms if studying RAB11B activity state .

Proper validation ensures experimental reproducibility and prevents misinterpretation of results due to antibody cross-reactivity.

What are the optimal conditions for immunoprecipitation of RAB11B?

Based on published protocols, successful immunoprecipitation of RAB11B requires careful consideration of several factors:

• Lysis buffer composition:

  • Use buffers containing 50 mM Tris-HCl (pH 7.4), 150 mM NaCl, 1 mM EDTA, 0.1% NP-40, and protease inhibitor cocktail .

  • For membrane-associated RAB11B, include mild detergents that preserve protein-protein interactions.

• Antibody amount:

  • Use 0.5-4.0 μg of RAB11B antibody for 1.0-3.0 mg of total protein lysate .

  • Pre-clear lysates with protein A/G beads to reduce non-specific binding.

• Incubation conditions:

  • Perform immunoprecipitation overnight at 4°C with gentle rotation .

  • For anti-FLAG tagged RAB11B, use pre-washed anti-FLAG M2 affinity gel beads .

• Washing steps:

  • Wash immunoprecipitates multiple times with cold lysis buffer.

  • Include control immunoprecipitations with non-specific IgG antibodies.

• Detection methods:

  • For RAB11B-specific immunoprecipitation from mouse brain tissue, use specific antibodies in Western blot detection .

  • For co-immunoprecipitation studies, consider detection of known RAB11B-interacting proteins.

When studying complexes of RAB11B with its effector proteins, note that the interaction between RAB11B and its binding partners may depend on RAB11B being membrane-associated, as demonstrated in experiments using C-terminally truncated RAB11B lacking the prenylation site .

How do different RAB11B mutants affect experimental outcomes?

Research has employed various RAB11B mutants to study its function, each producing distinct phenotypic effects:

• GDP-bound mutants (S25N):

  • Inhibit Ca²⁺-induced exocytosis in PC12 cells .

  • Significantly increase plasma membrane density of calcium channels in HEK293 cells .

  • Stimulate constitutive secretion and deplete secretory vesicle stores in PC12 cells .

  • Increase peak I₍Ba,L₎ by 98% in neonatal mouse cardiac myocytes .

• GTP-bound mutants (S20V and Q70L):

  • Inhibit Ca²⁺-dependent exocytosis in PC12 cells .

  • Have moderate effects on constitutive secretion without affecting vesicular stores .

  • Show identical inhibitory effects regardless of which GTP-bound mutant is used (S20V or Q70L) .

• C-terminal truncation mutant (ΔC-t):

  • Lacks the geranylgeranylation site required for membrane attachment.

  • Still inhibits Ca²⁺-dependent exocytosis despite inability to attach to membranes .

  • Interacts poorly with RAB11BP in vivo, suggesting membrane association is required for certain protein interactions .

• Effector domain mutant (T43A):

  • Fails to interact with RAB11BP in vivo .

  • Useful for studying the importance of effector domain integrity in RAB11B function.

When designing experiments using these mutants, researchers should consider cell type-specific effects, as GTP- and GDP-bound RAB11B inhibit Ca²⁺-induced (but not constitutive) exocytosis in neuroendocrine cells, while inhibiting constitutive exocytosis in non-neuronal cells .

What are the best methods for studying RAB11B localization?

For accurate RAB11B localization studies, consider these methodological approaches:

• Immunofluorescence optimization:

  • Recommended dilution range: 1:50-1:200 for IF/ICC applications .

  • For A549 cells, dilutions of 1:400-1:1600 have been validated .

  • Use paraformaldehyde fixation followed by permeabilization with 0.1% Triton X-100.

• Co-localization markers:

  • Endocytic recycling compartments: Transferrin receptor, RAB11FIP3

  • Secretory vesicles: Synaptic vesicle proteins in neuronal cells

  • Mitochondria: Mitochondrial structural and functional components

  • Cytokinesis structures: Acetylated-α-tubulin (marks intercellular bridge)

• Live-cell imaging:

  • GFP-RAB11B fusion proteins allow visualization of dynamic trafficking .

  • Compare localization patterns of GFP-RAB11A, GFP-RAB11B, and GFP-RAB25 in the same cell type .

• Ultrastructural localization:

  • Electron microscopy has revealed RAB11B's association with mitochondria in intestinal epithelial cells .

  • Immunogold labeling can provide precise subcellular localization.

• Cell type considerations:

  • RAB11B localizes to secretory vesicles in PC12 cells and mature synaptic vesicles in brain .

  • In dividing cells, RAB11B endosomes are distributed throughout the cytoplasm during metaphase and anaphase, concentrating at the cleavage furrow during telophase .

  • Cellular localization includes: cytoplasmic side, cytoplasmic vesicle, recycling endosome membrane, phagosome membrane, secretory vesicle, and synaptic vesicle membrane .

For unambiguous localization, combine multiple approaches and include appropriate controls, such as RAB11B knockdown or knockout samples.

How should I analyze RAB11B in knockout/knockdown studies?

When conducting RAB11B knockout or knockdown studies, several important methodological considerations should be addressed:

• Genetic manipulation approaches:

  • CRISPR-Cas9 knockout: Target regions overlapping exon 2 and exon 4 or exon 2 deletion as described in published Rab11b⁻/⁻ mouse models .

  • siRNA knockdown: Account for potential cross-regulation between RAB11 isoforms .

  • Verification PCR primers: Use primers flanking exon 2 (R11BE2F: CATTCTTGACTTACTCAGCTGTCA & R11BE2R: TGCTATCTCTAGGTCTTGACCCTA) for wild-type allele detection .

• Compensatory mechanisms:

  • Monitor RAB11A levels, as RAB11B knockdown leads to ~28.1% reduction in RAB11A protein .

  • Assess RAB25 expression, as it may compensate for RAB11B loss.

  • Examine expression of RAB11FIP family proteins and other downstream effectors.

• Phenotypic analysis:

  • Mitochondrial function: Examine mitochondrial morphology by electron microscopy and assess membrane potential and ROS production by flow cytometry .

  • Cellular trafficking: Evaluate recycling of transmembrane proteins and transferrin.

  • Cell division: Analyze cytokinesis completion using phalloidin (F-actin) and anti-acetylated-α-tubulin staining .

• Rescue experiments:

  • Use siRNA-resistant GFP-RAB11B constructs to confirm phenotype specificity .

  • Compare rescue efficiency between wild-type RAB11B and mutant forms (GDP-bound, GTP-bound).

• Controls and validation:

  • Confirm knockout/knockdown efficiency by Western blot using validated antibodies .

  • Perform side effect analysis of double or triple knockdowns to exclude off-target effects .

  • Use mice from different mating pairs to reduce genetic background effects in knockout studies .

These methodological considerations ensure robust interpretation of RAB11B function in complex biological systems.

What are the critical factors in analyzing RAB11B/effector protein interactions?

Investigation of RAB11B interactions with effector proteins requires careful experimental design:

• Nucleotide-loading conditions:

  • RAB11B's interaction with effector proteins is typically GTP-dependent .

  • Compare binding between wild-type, GTP-bound (S20V, Q70L), and GDP-bound (S25N) RAB11B mutants .

  • Include non-hydrolyzable GTP analogs (GTPγS) to stabilize active conformation.

• Membrane association requirements:

  • Some RAB11B-effector interactions only occur when RAB11B is membrane-associated .

  • C-terminally truncated RAB11B (RAB11BΔC) that cannot be prenylated interacts poorly with binding partners in vivo despite recognizing them in blotting assays .

• Detection methods:

  • Co-immunoprecipitation: Use anti-rab11 antibodies to pull down complexes from cells expressing epitope-tagged binding partners .

  • Binding assays: Purify recombinant proteins (e.g., MBP-fusion or GST-fusion) for direct interaction studies .

  • Yeast two-hybrid assays: Screen for novel RAB11B-interacting proteins.

• Cell fractionation approach:

  • Separate membrane (P100) and cytosolic (S100) fractions by ultracentrifugation (100,000 × g for 60 minutes) .

  • Analyze RAB11B-effector complexes in different subcellular compartments.

• Known RAB11B effectors to examine:

  • RAB11BP: Interacts with wild-type and GTP-bound RAB11B but not GDP-bound or effector domain mutants .

  • RAB11FIP family proteins: Important for recycling endosome function.

  • RAB3IP, ASAP1, ARF4: Form ciliary targeting complex with RAB11B .

  • WDR44: When phosphorylated upon LPAR1 activation, prevents RAB11B-RAB3IP-RAB11FIP3 complex formation .

Research on effector interactions should consider that RAB11B's involvement in various cellular processes may be mediated through distinct effector proteins in different cell types or physiological contexts.

How can I optimize Western blot protocols for RAB11B detection?

Successful Western blot detection of RAB11B requires attention to several technical details:

• Sample preparation:

  • For tissue samples: Brain, testis tissues from human, mouse or rat provide strong signal .

  • For cell lines: HEK-293/293T, Jurkat, PC-12, SH-SY5Y, RAW 264.7, NIH/3T3, and HeLa cells are suitable .

  • Use gentle lysis buffers containing protease inhibitors to prevent degradation.

• Antibody selection and dilution:

  • Different antibodies have different optimal dilution ranges:

    • 19742-1-AP: 1:300-1:600

    • 28498-1-AP: 1:1000-1:8000

    • CAB15350: 1:500-1:1000

    • Cell Signaling #2414: 1:1000

  • Perform titration experiments to determine optimal concentration.

• Detection considerations:

  • Expected molecular weight: 24 kDa (both calculated and observed) .

  • Loading controls: Use standard housekeeping proteins appropriate for your sample type.

  • Signal enhancement: Consider using enhanced chemiluminescence systems for better detection.

• Common issues and solutions:

  • Non-specific bands: Increase blocking time or concentration, optimize antibody dilution.

  • Weak signal: Increase protein loading, reduce antibody dilution, extend exposure time.

  • High background: Increase washing steps, optimize blocking conditions, check secondary antibody dilution.

• Specialized protocols:

  • For Product 28498-1-AP, a specific WB protocol is available from the manufacturer .

  • Consider cell type-specific modifications, as RAB11B expression varies across tissues.

Note that RAB11 antibodies vary in their specificity for RAB11B versus RAB11A. Some antibodies (like Cell Signaling #3539) detect both isoforms , while others are RAB11B-specific. Verify the specificity of your chosen antibody before interpreting results.

What are the common pitfalls in RAB11B research and how can they be avoided?

Several methodological challenges can affect RAB11B research quality and reproducibility:

• Isoform-specific detection challenges:

  • Problem: RAB11A and RAB11B share ~90% sequence identity, making specific detection difficult.

  • Solution: Use validated isoform-specific antibodies ; confirm specificity using knockout/knockdown controls; include both RAB11A and RAB11B in expression analyses.

• Mutant overexpression artifacts:

  • Problem: Expression levels of different RAB11B mutants may vary dramatically, leading to misinterpretation.

  • Solution: Use GFP fusion proteins to compare expression levels ; quantify expression by Western blot; use inducible expression systems to control protein levels.

• Functional redundancy issues:

  • Problem: RAB11A may compensate for RAB11B deficiency and vice versa.

  • Solution: Consider double knockdowns with careful controls ; examine both isoforms simultaneously; use rescue experiments with isoform-specific constructs.

• Cell type-specific effects:

  • Problem: RAB11B functions differently in neuronal versus non-neuronal cells .

  • Solution: Validate findings in multiple cell types; consider tissue context when interpreting results; use appropriate cell models for your research question.

• GDP/GTP binding state confusion:

  • Problem: Both GDP-bound and GTP-bound RAB11B can inhibit exocytosis but through different mechanisms .

  • Solution: Include both mutant types in experiments; measure multiple functional outcomes; consider downstream effects beyond simple inhibition/activation.

• Technical issues with IHC/IF:

  • Problem: Poor signal or high background in immunostaining.

  • Solution: Optimize antigen retrieval (use TE buffer pH 9.0 or citrate buffer pH 6.0) ; titrate antibody concentration; include appropriate positive and negative controls.

• Mitochondrial analysis challenges:

  • Problem: Recent findings on RAB11B's role in mitochondrial integrity require specialized techniques .

  • Solution: Use electron microscopy for morphological analysis; employ flow cytometry for membrane potential and ROS production; combine with biochemical assays for comprehensive assessment.

By anticipating these challenges, researchers can design more robust experiments and avoid common pitfalls in RAB11B investigations.

How do I select the appropriate RAB11B antibody for my specific application?

Selecting the optimal RAB11B antibody requires evaluation of several key factors:

• Application compatibility:

  • For Western blot: Almost all RAB11B antibodies are validated .

  • For IP: Antibodies 19742-1-AP and monoclonal antibodies like ab249892 are recommended .

  • For IHC: Consider antibodies 19742-1-AP (1:20-1:200) or 28498-1-AP (1:50-1:500) .

  • For IF/ICC: 28498-1-AP (1:400-1:1600) and ab228954 have been successfully used .

  • For Flow Cytometry: Ab249892 has been validated for intracellular staining .

• Host species considerations:

  • Rabbit-derived antibodies: Most commercially available options (19742-1-AP, 28498-1-AP, ab228954, #2414) .

  • Goat-derived antibodies: AffiAB® Goat Anti-Rab11b offers an alternative host species .

  • Consider host species when designing multi-color immunostaining experiments.

• Clonality options:

  • Polyclonal antibodies: Provide high sensitivity but may have batch-to-batch variation .

  • Monoclonal antibodies: Offer higher specificity and reproducibility (ab249892) .

  • Recombinant antibodies: Provide consistency between lots (ab249892) .

• Specificity requirements:

  • For RAB11B-specific detection: Choose antibodies validated against other Rab family members.

  • For pan-RAB11 detection: The Cell Signaling #3539 antibody detects both RAB11A and RAB11B .

  • Verify specificity in your experimental system with appropriate controls.

• Special considerations:

  • Carrier-free options: Available for specialized applications (ab249892) .

  • BSA and azide-free preparations: Suitable for conjugation or in vivo applications.

  • Peptide versus full-protein immunogens: Consider for epitope accessibility in your application.

For optimal results, review the validation data provided by manufacturers, including positive control samples (e.g., HeLa cells, mouse/rat brain tissue) and recommended dilutions for each application. When possible, test multiple antibodies to identify the best performer in your specific experimental system.

What recent developments highlight new roles for RAB11B in cellular function?

Recent research has revealed several novel functions of RAB11B beyond its established role in endocytic recycling:

• Mitochondrial integrity and function:

  • Recent proteomic analysis has uncovered an association between RAB11B and mitochondrial structural and functional components .

  • Rab11b knockout mouse intestinal epithelial cells display abnormal mitochondrial morphologies when examined by electron microscopy .

  • Flow cytometry analysis demonstrated that epithelial cells from Rab11b knockout mice exhibit impaired mitochondrial membrane potential and reactive oxygen species (ROS) production .

  • This previously unappreciated contribution of RAB11B to mitochondrial homeostasis opens new research directions.

• Mitotic spindle function:

  • RAB11 small GTPases and associated recycling endosomes have been localized to mitotic spindles and implicated in regulating mitosis .

  • RAB11A and RAB11B specifically control mitotic spindle function in intestinal epithelial cells .

  • This finding connects RAB11B to cell division regulation beyond its role in cytokinesis.

• Cytokinesis regulation:

  • RAB11B contributes to actin removal from the intercellular bridge to complete cytokinesis .

  • The protein regulates telophase and final cytokinetic division in mammalian cells by concentrating at the cleavage furrow .

  • Mechanistically, this involves mediating cortical actin depolymerization at the abscission site by recruiting and transporting proteins that inhibit RhoGTPase activity .

• Calcium channel regulation:

  • RAB11B S25N (GDP-bound form) leads to a 1.7-fold increase in plasma membrane density of hemagglutinin epitope-tagged Ca₍v₎1.2 expressed in HEK293 cells .

  • This mutant slows degradation of plasmalemmal Ca₍v₎1.2 channels rather than affecting anterograde trafficking .

  • In neonatal mouse cardiac myocytes, RAB11B S25N significantly increases peak I₍Ba,L₎ by 98% .

  • This represents a novel role where RAB11B limits, rather than promotes, plasma membrane expression of certain channels.

These emerging functions suggest RAB11B plays more diverse roles in cellular homeostasis than previously appreciated, opening new avenues for investigation in cell biology, neurobiology, and cardiac physiology.

How can RAB11B research inform our understanding of disease mechanisms?

The multifaceted functions of RAB11B suggest its involvement in various disease processes, providing opportunities for translational research:

• Neurological disorders:

  • RAB11B is enriched in brain tissue and regulates Ca²⁺-induced exocytosis in neuronal cells .

  • Its role in synaptic vesicle function suggests potential implications for synaptopathies and neurodegenerative diseases.

  • Research methodology: Examine RAB11B expression and function in patient-derived neurons or brain organoids; investigate genetic variants in RAB11B in neurological disorders.

• Cardiac pathophysiology:

  • RAB11B regulates calcium channel density in cardiac myocytes, affecting cardiac excitability .

  • Potential relevance to arrhythmias and heart failure through modulation of calcium signaling.

  • Research methodology: Study RAB11B function in cardiomyocyte models of disease; investigate RAB11B-targeted interventions for calcium channel regulation.

• Mitochondrial diseases:

  • Recent discovery of RAB11B's role in mitochondrial integrity and function in intestinal epithelial cells .

  • Potential involvement in mitochondriopathies affecting the gut and other tissues.

  • Research methodology: Characterize mitochondrial defects in Rab11b⁻/⁻ models; investigate RAB11B expression in patient samples with mitochondrial dysfunction.

• Cancer biology:

  • RAB11B's functions in cell division, mitotic spindle regulation, and cytokinesis suggest potential roles in uncontrolled proliferation.

  • Research methodology: Analyze RAB11B expression in cancer tissues; study effects of RAB11B modulation on cancer cell proliferation and migration; investigate its role in resistance to anti-mitotic therapies.

• Intestinal disorders:

  • RAB11B knockout affects gut epithelial cell mitochondrial function , potentially impacting intestinal barrier integrity.

  • Possible connections to inflammatory bowel diseases and other intestinal pathologies.

  • Research methodology: Investigate intestinal permeability and inflammation in Rab11b⁻/⁻ models; analyze RAB11B expression in patient biopsies.