ADIPOR1 Antibody

What is ADIPOR1 and why is it significant for research?

ADIPOR1 (Adiponectin Receptor 1) is a 375 amino acid multipass transmembrane protein that functions as a receptor for adiponectin. Its significance stems from its critical role in metabolic pathways, where it mediates increased fatty acid oxidation and glucose uptake by adiponectin. More surprisingly, ADIPOR1 protein is predominantly expressed in the eye and brain, with significantly lower expression in other tissues . This tissue-specific distribution pattern makes it a compelling target for research on metabolic disorders and, notably, retinal degeneration, as knockout of ADIPOR1 has been demonstrated to cause visual system abnormalities .

What are the optimal sample preparation conditions for ADIPOR1 antibody experiments?

ADIPOR1 protein exhibits remarkable temperature sensitivity that researchers must account for in experimental design. When preparing protein samples for SDS-PAGE analysis, heating samples to temperatures of 60°C or greater causes a significant loss of detectable signal . For optimal results, protein samples should only be heated to a temperature of 37°C before SDS-PAGE analysis. Even brief exposure (1 minute) to 95°C can strongly reduce detectible signal . Additionally, if precipitates form in antibody solutions, microcentrifugation before use is recommended .

What is the tissue distribution profile of ADIPOR1 protein?

Western blot analysis of different mouse tissues reveals that ADIPOR1 protein has a highly specific distribution pattern:

This distinct expression profile contradicts some earlier research that relied primarily on transcript levels, highlighting the importance of protein-level analysis as mRNA levels do not always correlate well with protein abundance, especially across different tissues .

How does ADIPOR1 localize within retinal tissues?

Immunohistochemistry analysis of ADIPOR1 in mouse retinal tissue reveals a specific localization pattern:

In human retina, the protein shows interesting differences with enrichment on the apical side of the RPE layer, while mRNA is distributed throughout the neural retina and RPE .

What methodological approaches can distinguish between ADIPOR1 expression in neural retina versus RPE?

When investigating ADIPOR1 expression in ocular tissues, employing complementary techniques is crucial for accurate localization. For isolated tissue analysis, western blotting on separately dissected eye samples (neural retina and posterior eye cup containing RPE) is recommended. Validation of proper tissue separation should include markers such as RPE65 (for RPE) and RHODOPSIN (for photoreceptors/neural retina) .

How can researchers validate ADIPOR1 antibody specificity for their experimental systems?

A rigorous validation strategy for ADIPOR1 antibody specificity should include:

• Testing the antibody on both overexpressed and endogenous protein

• Including appropriate knockout (KO) controls

• Verifying detection across multiple applications (western blot, IHC)

Research has demonstrated that many commercial antibodies claiming ADIPOR1 reactivity fail specificity tests. In a comprehensive screen of fifteen anti-ADIPOR1 antibodies, only five could detect exogenous ADIPOR1, and only one could reliably detect the endogenous protein . Researchers should generate ADIPOR1 knockout cells (using CRISPR-Cas9 or similar technology) as negative controls to conclusively validate antibody specificity before proceeding with experiments .

What are the critical parameters for detecting ADIPOR1 in western blotting experiments?

Successful western blotting for ADIPOR1 requires attention to several critical parameters:

Researchers should note that ADIPOR1, like other membrane proteins, is vulnerable to heat-induced aggregation that can prevent detection .

What are the optimal fixation and tissue preparation methods for ADIPOR1 immunohistochemistry?

The detection method for ADIPOR1 varies depending on the tissue type and preparation method:

For frozen mouse eye sections:

• Fix whole eyes in ice-cold 3.2% PFA made in PBS (pH 7.4) for 30 minutes

• Wash with PBS and cryoprotect in 20% sucrose in PBS overnight at 4°C

• Embed in OCT and freeze

• Section at 10-16 μm thickness

• Block with 10% Normal Goat Serum with 0.01% Triton-X-100 in PBS

• Incubate with primary antibody overnight at room temperature

• Use appropriate fluorescent secondary antibodies (e.g., Goat anti-Rabbit Alexa-647)

For paraffin-embedded human eye sections:

• Fix tissues with Modified Davidson's Fixative for two days

• Follow with 70% ethanol for another two days

• Process and embed in paraffin

• Section at 5 μm thickness

• Use automated detection systems such as Leica Bond RX

• Apply anti-ADIPOR1 antibody at 1:50 dilution

• Detect using appropriate chromogenic detection systems

How should researchers approach validation of ADIPOR1 knockout models?

Validation of ADIPOR1 knockout models requires multiple levels of confirmation:

• DNA level validation: Sequence the targeted ADIPOR1 locus to confirm successful gene editing. For CRISPR-Cas9 approaches, gRNAs targeting specific sequences (e.g., GGAAGCTGACACGGTGGAAC and AGCCAGATGTCTTCCCACAA) can be used, with non-targeting gRNAs as controls .

• Protein level validation: Use western blotting with a validated antibody to confirm absence of ADIPOR1 protein. Include wild-type controls processed under identical conditions .

• Phenotypic validation: Examine known ADIPOR1-dependent phenotypes, such as retinal degeneration or RHODOPSIN levels in the case of ocular research .

• Cell selection process: For cell line knockouts, implement appropriate selection strategies (e.g., puromycin selection at 5 μg/mL for 4 days) followed by single-cell cloning to establish homogeneous knockout populations .

How can researchers address weak or absent ADIPOR1 signals in western blotting?

When troubleshooting weak or absent ADIPOR1 signals in western blotting, consider the following strategies:

Additionally, if the antibody solution contains precipitates, microcentrifugation before use is recommended to remove aggregates that might interfere with antibody binding .

What controls are essential for ADIPOR1 immunostaining experiments?

Rigorous ADIPOR1 immunostaining requires multiple controls:

• Negative controls:

  • ADIPOR1 knockout tissues/cells

  • No primary antibody controls to assess secondary antibody specificity

  • Non-targeting gRNA-treated controls for CRISPR experiments

• Positive controls:

  • Tissues known to express high ADIPOR1 levels (eye and brain)

  • Overexpression systems (e.g., plasmid-transfected cells)

• Technical controls:

  • Exposure settings should be established using knockout controls

  • For in situ hybridization, include both positive control probes (e.g., POLR2A) and negative control probes (e.g., dapB of Bacillus subtilis)

How does ADIPOR1 expression change in metabolic disorders and its potential impact on experimental design?

Research indicates that ADIPOR1 expression in adipose tissue decreases in obese humans, while weight loss results in increased expression . This dynamic regulation has important implications for experimental design when studying metabolic disorders:

• Control for metabolic status: Document and control for BMI, metabolic parameters, and feeding status of research subjects or animal models

• Time-course considerations: Design experiments to capture both acute and chronic changes in ADIPOR1 expression following metabolic interventions

• Tissue-specific analysis: Given the differential expression across tissues, conduct parallel analyses of ADIPOR1 in multiple relevant tissues (adipose, eye, brain) to comprehensively assess systemic effects

• Functional correlation: Correlate ADIPOR1 expression changes with functional readouts such as fatty acid oxidation and glucose uptake to establish physiological significance

What are the implications of ADIPOR1's role in retinal function for experimental design in vision research?

The critical role of ADIPOR1 in maintaining retinal function introduces specific considerations for vision research:

• Developmental vs. adult phenotypes: ADIPOR1 knockout causes early visual system abnormalities and RHODOPSIN depletion prior to photoreceptor degeneration. Conditional knockout studies have established that ADIPOR1 also supports vision in adulthood .

• Cell type-specific effects: Consider the differential expression and function of ADIPOR1 in photoreceptors versus RPE cells. Knockout in either cell type results in decreased expression of retinal proteins .

• Connection to retinoid metabolism: ADIPOR1 knockout leads to elevated and abnormally distributed IRBP (Interphotoreceptor Retinoid-Binding Protein), suggesting involvement in retinoid metabolism. Experiments should include analysis of retinoid processing markers .

• Relationship to MFRP: The Mfrprd6 mouse model lacks ADIPOR1 specifically in the RPE layer, indicating potential functional or regulatory relationships between these genes that warrant investigation in parallel .