RAI14 Antibody

What is RAI14 and what cellular functions does it mediate?

RAI14 (Retinoic Acid-Induced protein 14), also known as Ankycorbin or NORPEG, was originally discovered in human retinal pigment epithelial cells induced by all-trans retinoic acid . This protein plays multiple crucial roles in cellular physiology:

• Cytoskeletal organization: RAI14 is closely associated with the actin cytoskeleton, contributing to cellular architecture maintenance .

• Reproductive biology: Highly expressed in testicular tissue and sperm, RAI14 is important for establishment of sperm polarity and normal spermatid adhesion .

• Blood-testis barrier integrity: May promote integrity of Sertoli cell tight junctions .

• Dendritic spine dynamics: Controls dendritic spine morphology and synaptic function in neurons .

• Cellular migration and invasion: Involved in regulating cell migration, particularly in cancer cells .

For experimental validation of RAI14 function, both gain-of-function (overexpression) and loss-of-function (knockdown) approaches should be employed to comprehensively characterize its biological activities in your model system.

What are the most reliable methods for detecting RAI14 expression in experimental samples?

Several validated techniques are available for RAI14 detection:

For optimal results when detecting RAI14, consider these methodological recommendations:

• Use fresh or properly stored samples to avoid protein degradation

• Include positive control samples (testicular tissue or gastric cancer cell lines show high expression)

• Validate antibody specificity using RAI14 knockdown controls

How is RAI14 expression distributed across different tissues and cell types?

RAI14 shows a distinct tissue distribution pattern that has important implications for experimental design:

• High expression: Testicular tissue, sperm, retinal pigment epithelial cells

• Moderate expression: Brain tissue (particularly in dendritic spines)

• Pathological expression: Significantly upregulated in multiple cancer types:

  • Gastric cancer (strongly associated with poor prognosis)

  • Melanoma (correlated with tumor progression)

  • Breast, cervical, esophageal, head and neck cancers, lymphomas, and sarcomas

• Decreased expression: Observed in colorectal and pancreatic cancer

When designing experiments, researchers should consider these expression patterns for selecting appropriate positive and negative control tissues. For instance, comparing RAI14 expression between normal gastric tissue and gastric cancer specimens provides a reliable experimental paradigm with consistent differential expression.

How does RAI14 expression correlate with cancer prognosis, and what methodologies best demonstrate this relationship?

Multiple studies have established RAI14 as a prognostic biomarker in cancer. The most robust evidence exists for gastric cancer:

For methodological approaches to study this relationship:

• Perform immunohistochemical staining of tissue microarrays with validated RAI14 antibodies

• Quantify expression using H-score or similar scoring systems

• Correlate expression with clinicopathological parameters using Kaplan-Meier survival analysis

• Validate findings using public databases (Oncomine, TIMER, UALCAN, Kaplan-Meier Plotter)

For melanoma research specifically, recent studies show that RAI14 knockdown inhibits tumor growth in vivo, suggesting its potential as a therapeutic target .

What is the relationship between RAI14 expression and immune cell infiltration in the tumor microenvironment?

RAI14 expression shows significant correlations with immune cell infiltration in the tumor microenvironment, particularly in gastric cancer:

• Positive correlations have been observed between RAI14 expression and infiltration of:

  • Monocytes

  • Tumor-associated macrophages (TAMs)

  • M2 macrophages

  • Neutrophils

  • Regulatory T cells (Tregs)

  • Follicular helper T cells (Tfh)

  • Dendritic cells

To investigate these relationships:

• Use multiplexed immunohistochemistry with antibodies against RAI14 and immune cell markers

• Perform flow cytometry on tumor-infiltrating immune cells with RAI14 co-staining

• Analyze single-cell RNA sequencing data to correlate RAI14 expression with immune cell populations

• Utilize the TIMER database to examine correlations between RAI14 expression and immune cell markers

The research suggests RAI14 plays a vital role in regulating tumor-associated macrophages, dendritic cells, and regulatory T cells. RAI14 expression was positively correlated with M2 macrophage markers (CD163, VSIG4, and MS4A4A) and TAM markers (CCL2 and IL-10), indicating a potential regulatory role in TAM polarization .

How can I optimize immunoprecipitation protocols using RAI14 antibodies for protein interaction studies?

Based on published protocols, here is an optimized immunoprecipitation method for RAI14:

Materials needed:

• RAI14 rabbit polyclonal antibody (validated for IP applications)

• Protein A/G magnetic beads

• Cell lysis buffer (containing protease inhibitors)

• Wash buffers (varying stringency)

• SDS-PAGE materials

Step-by-step protocol:

• Prepare cell lysate (1 mg protein recommended for optimal results)

• Pre-clear lysate with protein A/G beads (1 hour, 4°C)

• Incubate pre-cleared lysate with 6 μg RAI14 antibody overnight at 4°C

• Add protein A/G beads and incubate for 2 hours at 4°C

• Wash beads 4-5 times with wash buffer

• Elute with SDS-PAGE loading buffer

• Analyze by Western blot using RAI14 antibody (1 μg/ml concentration)

Critical considerations:

• Include appropriate controls (IgG isotype control is essential)

• When investigating novel interactions, confirm bidirectionally by pulling down with antibodies against both RAI14 and the suspected interaction partner

• For detecting the RAI14-Invariant chain interaction, use human melanoma cell line MelJuSo as a model system for antigen-presenting cells

This protocol has successfully demonstrated interactions between RAI14 and proteins such as Invariant chain and myosin II .

What approaches can be used to study the role of RAI14 in cytoskeletal organization and cellular architecture?

RAI14's involvement in cytoskeletal organization requires specialized techniques:

Live cell imaging approaches:

• Transfect cells with Rai14-GFP constructs to visualize localization at membrane ruffles and internalization into vesicles

• Co-transfect with LifeAct constructs (prepared by cloning into pEGFP-N1 and dsRed-N1) to simultaneously visualize F-actin

• For dendritic spine analysis, use maximal intensity projection of z-stacks to classify Rai14-GFP clusters into different spine compartments (head, neck, base)

Quantitative analysis methods:

• For spine distribution analysis, count and classify RAI14-GFP clusters on dendritic segments into seven classes:

  • Rai14 at spine head + neck + base

  • Rai14 at spine head only

  • Rai14 at spine head + neck

  • Rai14 at spine neck only

  • Rai14 at spine neck + base

  • Rai14 at spine base only

  • Rai14 at non-spine region

• Calculate the fraction of RAI14 at spine neck using the formula:
  (sum of 'Rai14 at spine head + neck + base, head + neck, neck only and neck + base' / all Rai14 clusters within the designated dendritic segment) x100

Functional assays:

• Study macropinocytosis by analyzing MHC II internalization in antigen-presenting cells with or without RAI14 depletion

• Investigate cell migration using transwell assays to confirm RAI14's negative regulatory role in cell motility

What are the methodological considerations for generating and validating RAI14 knockdown/knockout models?

Creating effective RAI14 loss-of-function models requires attention to several key factors:

For CRISPR/Cas9-mediated knockout:

• Target sgRNA sequence examples: 5′-CCGTCTGCTGCAGGCTGTGGAGA-3′ and 5′-GAGAAGGTGGCCTCACTGCTGGG-3′

• Verification primers: forward 5′-GGAGTTTGCTGATGGCTGGTATT-3′ and reverse 5′-CTCCATCGCCAACACTGTAAGAA-3′

• Microinject Cas9 mRNA and sgRNA into mouse zygotes and transfer into pseudopregnant females

For shRNA-mediated knockdown:

• Human RAI14 shRNA core sequence: TCGGGAAAGGAATCGGTATTT

• Mouse RAI14 shRNA core sequence: CGAACACTGTGGACGCCTTAA

• Use pLentiLox3.7 vector with TCTCTTGAA as the loop sequence

Validation approaches:

• Protein level: Western blot using validated RAI14 antibodies

• mRNA level: RT-PCR

• Functional validation:

  • For melanoma studies: Assess cell proliferation (MTT assay, plate clone assay), migration (transwell assay), and in vivo tumor growth (subcutaneous xenograft assay)

  • For neuronal studies: Analyze dendritic spine dynamics and synaptic function

  • For fertility studies: Assess spermatogenesis and fertility parameters

Important consideration: Rai14 knockout in mice showed normal fertility and complete spermatogenesis, which contradicted results from Rai14 knockdown in rats, highlighting the importance of validating phenotypes across different model systems .

How does RAI14 contribute to cancer progression mechanisms at the molecular level?

RAI14 influences cancer progression through multiple mechanisms:

In gastric cancer:

• High RAI14 expression correlates with late stage and poor differentiation

• Knockdown inhibits migration and invasion of gastric cancer cells (MKN45 and AGS)

• Accelerates cell apoptosis via downregulation of Bcl-2 and upregulation of Bax

• Inhibits activation of the Akt pathway (reactivation of Akt by IGF-1 restores the reduced proliferation induced by RAI14 knockdown)

In melanoma:

• RAI14 regulates the FBXO32-mediated ubiquitination of c-MYC

• Knockdown of RAI14 can significantly reduce the expression of RAI14, Ki67, and c-MYC, whereas the expression of FBXO32 (an E3 ubiquitin ligase of c-MYC) is elevated

• RAI14 knockdown significantly inhibits the cell proliferation, migration, and invasion of melanoma cells

• In vivo studies demonstrate that RAI14 knockdown reduces tumor volume and weight in subcutaneous xenograft models

To investigate these mechanisms, recommended approaches include:

• Western blot analysis of signaling pathway components (Akt, c-MYC, FBXO32)

• Co-immunoprecipitation to study protein interactions

• Ubiquitination assays to examine post-translational modifications

• Soft agar assays to assess tumor cell self-renewal capacity

What is known about RAI14 interaction with the immune system, and how can this be further investigated?

RAI14 demonstrates significant involvement in immune processes:

Key findings:

• RAI14 is a novel interactor of Invariant chain (Ii) in antigen-presenting cells

• It localizes to membrane ruffles where it forms macropinosomes

• RAI14 depletion delays MHC II internalization, affecting macropinocytic activity

• Functions as a positive regulator of macropinocytosis and a negative regulator of cell migration in antigen-presenting cells

• Binds to myosin II, suggesting that Ii, myosin II, and RAI14 work together to coordinate macropinocytosis and cell motility

In tumor immunology:

• RAI14 expression correlates with markers of various immune cells in gastric cancer

• Significant correlations with markers of:

  • T cells: CD8+ T cells, Th1, Th2, Tfh, Th17, Tregs

  • B cells

  • Macrophages: TAMs, M1, M2

  • Other: Neutrophils, NK cells, Dendritic cells

Research methodologies:

• Co-immunoprecipitation to confirm protein interactions (e.g., with Ii and myosin II)

• Live cell imaging with Rai14-GFP and fluorescently labeled antibodies targeting immune markers

• Macropinocytosis assays using fluorescent dextran uptake

• Cell migration assays (transwell, wound healing) to assess motility

• Bioinformatic analysis using TIMER database to correlate RAI14 expression with immune cell markers

This research area presents significant opportunities for understanding RAI14's dual role in regulating both macropinocytosis and cell migration in immune cells.

Technical Considerations for RAI14 Antibody Selection and Validation

Thorough validation ensures reliable results. Implement these approaches:

Positive controls:

• Use tissues/cells known to express high levels of RAI14:

  • Testicular tissue

  • Retinal pigment epithelial cells

  • Gastric cancer cell lines (e.g., MKN45, AGS)

  • Melanoma cell lines (e.g., MV3 shows particularly high expression)

Negative controls:

• Use RAI14 knockdown/knockout samples:

  • shRNA-mediated knockdown using validated sequences

  • CRISPR/Cas9-mediated knockout

• Include isotype control antibodies in immunoprecipitation experiments

Cross-validation methods:

• Compare results from multiple antibodies targeting different epitopes

• Correlate protein detection with mRNA expression data

• For subcellular localization studies, confirm RAI14 distribution using both immunofluorescence and fractionation approaches (RAI14 is expressed in both nucleus and cytoplasm)

• For restoration experiments, perform RAI14 overexpression in knockdown cells to confirm specificity of observed phenotypes

Western blot considerations:

• RAI14 has a molecular weight of approximately 110 kDa

• Confirm band specificity by demonstrating reduced/absent signal in knockdown samples

• Use fresh samples and include protease inhibitors to prevent degradation

How can RAI14 antibodies be utilized in studying dendritic spine dynamics and synaptic function?

RAI14 plays a critical role in neuronal structures, particularly dendritic spines:

Recommended protocols:

• Transfection approach:

  • Transfect neurons with Rai14-GFP constructs

  • For deletion mutant studies, amplify regions of human Rai14 by PCR and clone into pEGFP-N1 and pEGFP-C3

• Imaging and analysis:

  • Use confocal microscopy with z-stacks

  • Project z-stacks with maximal intensity projection using cellSens software (Olympus)

  • Classify Rai14-GFP clusters into seven subcellular categories as detailed earlier

• Synapse quantification:

  • For quantification of synapse-bearing spines, perform deconvolution using advanced constrained iterative (CI) algorithm

  • Determine co-localization of synaptic markers with dendritic spines in merged images using ImageJ

  • Calculate the fraction of synaptic clusters co-localized with dendritic spines relative to entire spines

• Functional assays:

  • Assess spine morphology changes in response to stimulation

  • Examine effects of RAI14 knockdown on spine dynamics

  • Investigate interactions with other cytoskeletal components using co-immunoprecipitation

This approach has revealed important insights about RAI14's role in controlling dendritic spine dynamics associated with stress-induced depressive-like behaviors .

What is the current understanding of RAI14's role in tumor immune microenvironment and its implications for immunotherapy?

RAI14 appears to be a key mediator in the tumor immune microenvironment:

Key findings:

• RAI14 expression correlates with infiltration of multiple immune cell types in gastric cancer

• High expression is associated with immunosuppressive phenotypes (M2 macrophages, Tregs)

• May influence tumor progression through regulation of the immune microenvironment

Potential mechanisms:

• Macrophage polarization: RAI14 expression correlates with M2 macrophage markers (CD163, VSIG4, MS4A4A) and TAM markers (CCL2, IL-10)

• T cell regulation: Correlation with Treg markers (CCR8, STAT5B, TGFB1) suggests RAI14 may activate regulatory T cells

• Dendritic cell function: Strong relationship between RAI14 and dendritic cell infiltration; dendritic cells can promote tumor metastasis by increasing Treg cells and reducing CD8+ T cell cytotoxicity

Research approaches:

• Use multiplexed immunohistochemistry to simultaneously visualize RAI14 and immune cell markers

• Perform co-culture experiments with RAI14-expressing tumor cells and immune cells

• Investigate effects of RAI14 inhibition on immune checkpoint blockade efficacy

• Analyze correlation between RAI14 expression and response to immunotherapy in patient cohorts

This emerging area suggests RAI14 could potentially serve as both a prognostic biomarker and a therapeutic target for enhancing immunotherapy responses in gastric cancer and other malignancies .