RALY (RNA-binding protein Raly) functions as a nuclear ribonucleoprotein primarily localized in the nucleus with partial distribution in the cytoplasm. It contains an RNA recognition motif (RRM) that facilitates interaction with RNA molecules . Recent research has identified RALY as a critical inhibitor of viral replication, specifically for foot-and-mouth disease virus (FMDV), where it binds to domain 3 of the FMDV IRES and blocks 80S ribosome assembly, thus inhibiting IRES-driven translation . This antiviral activity makes RALY an important target for understanding host-pathogen interactions and potential therapeutic development.
Currently, rabbit polyclonal antibodies against RALY are most commonly used in research settings. These include antibodies generated against recombinant fusion proteins containing amino acid sequences corresponding to human RALY (NP_057951.1) . Commercially available options include the HPA043614 antibody from Atlas Antibodies and the A81095 antibody with documented reactivity against human, mouse, and rat RALY . These polyclonal antibodies are typically affinity-purified and supplied in buffers containing phosphate-buffered saline with glycerol and preservatives .
RALY antibodies have been validated for multiple research applications including:
Western blotting (WB) with recommended dilutions of 1:500-1:1,000
Immunohistochemistry (IHC) in tissues such as testis and liver
RNA immunoprecipitation (RIP) for studying RNA-protein interactions
Immunoprecipitation (IP) assays to investigate protein-protein interactions
Sucrose gradient fractionation studies to analyze ribosomal association
Each application requires specific optimization protocols to ensure reliable results in detecting the approximately 38 kDa RALY protein .
For effective RNA immunoprecipitation using RALY antibodies:
Infect target cells (e.g., BHK-21) with virus of interest at appropriate MOI (e.g., MOI=1)
At specified timepoint post-infection (e.g., 5 hpi), harvest and lyse cells with RIPA buffer containing protease and RNase inhibitors
Pre-clear lysate with protein G beads for 1 hour on ice
Add 8 μL of anti-RALY antibody (include IgG and no-antibody controls)
Incubate overnight at 4°C with rotation
Add pre-treated protein G beads and incubate 2-4 hours at 4°C
Collect immune complexes by centrifugation (3,000 × g, 5 min, 4°C)
Wash three times with lysis buffer
Extract RNA with TRIzol reagent
This protocol has successfully demonstrated RALY's interaction with FMDV IRES elements, establishing its role in antiviral activity .
For optimal Western blotting results with RALY antibodies:
Separate proteins via SDS-PAGE
Transfer to PVDF membranes
Block with 1× TBST containing 5% skimmed milk for 1 hour
Incubate with anti-RALY primary antibody (1:500-1:1,000 dilution) overnight at 4°C
Wash four times with 1× TBST (5 minutes each)
Incubate with HRP-labeled secondary antibody (1:4,000 dilution)
Wash four times with 1× TBST (5 minutes each)
Develop using ECL chromogenic solution and expose
Including positive controls (RALY-expressing tissues) and negative controls (knockdown samples) enhances result reliability. Western blotting has been crucial in demonstrating RALY degradation during viral infection and confirming successful knockdown/overexpression in experimental designs .
To investigate RALY's association with translation machinery:
Polysome profiling:
Co-immunoprecipitation:
These approaches have revealed that RALY associates with 40S ribosomal subunits and translation initiation factors, particularly in virus-infected cells, supporting its role in translation regulation .
RALY exhibits antiviral activity through a specific molecular mechanism:
RALY binds to domain 3 (D3) of the FMDV IRES through its RNA recognition motif (RRM)
This binding does not prevent the assembly of translation initiation complexes with 40S ribosomes
Instead, RALY specifically blocks the formation of 80S ribosome complexes on the FMDV IRES after 40S binding
This inhibition prevents viral mRNA translation and subsequent viral protein synthesis
RALY shows stronger binding to translation components in virus-infected cells compared to uninfected cells
Importantly, FMDV has evolved a countermeasure: its 3C protease targets RALY for degradation via the ubiquitin-proteasome pathway, neutralizing this host defense mechanism . This represents a classic example of the evolutionary arms race between host antiviral factors and viral countermeasures.
For effective RALY manipulation experiments:
RALY knockdown:
Transfect cells with RALY-specific siRNA (e.g., siRALY-sense 5′-GCCUUUGUCCAGUAUGCCATT-3′) and negative control siRNA
Incubate for 36-48 hours
Validate knockdown efficiency by Western blotting with RALY antibodies
Infect with virus (e.g., FMDV at MOI=1)
Collect samples at various timepoints (1, 3, 5, 7, 9 hpi)
Analyze viral replication by qPCR, TCID50, and Western blotting
RALY overexpression:
Transfect cells with Flag-RALY expression plasmid or empty vector
Incubate for 24 hours
Confirm overexpression by Western blotting
Infect with virus
These experiments typically show enhanced viral replication upon RALY knockdown and reduced replication with overexpression, confirming RALY's antiviral function.
When investigating RALY-RNA interactions, include these critical controls:
Input control: Analyze a portion of pre-immunoprecipitation lysate to confirm target RNA presence
Negative antibody control: Use isotype-matched IgG to assess non-specific binding
No-antibody control: Process samples without antibody addition
Non-target RNA controls: Include primers for housekeeping RNAs (e.g., RPS16, GAPDH) that shouldn't associate with RALY
RNase treatment control: Treat parallel samples with RNase to confirm RNA-dependent interactions
Competitive binding controls: Use known RALY-binding RNAs as competitors
The FMDV research included appropriate control amplifications of housekeeping genes (RPS16, GAPDH) and multiple viral RNA regions to establish binding specificity to the IRES element .
To examine how RALY associations change during infection:
Comparative immunoprecipitation:
Subcellular fractionation:
Separate nuclear and cytoplasmic compartments
Perform Western blotting for RALY in each fraction
Compare distribution patterns between mock and infected states
Sucrose gradient analysis:
Such approaches have revealed that during FMDV infection, RALY shows increased association with 40S ribosomal subunits and translation initiation factors, including cleaved eIF4G, eIF3A, eIF3e, eIF4A, and eIF2α but not eIF5B .
For studying RALY modifications during viral infection:
2D gel electrophoresis:
Immunoprecipitate RALY from mock and infected cells
Separate by isoelectric focusing followed by SDS-PAGE
Western blot with RALY antibodies to detect charge or size shifts
Modification-specific detection:
Immunoprecipitate RALY from infected and uninfected cells
Probe with antibodies against specific modifications (ubiquitin, SUMO, phospho-groups)
Compare modification patterns between conditions
In vitro modification assays:
Express recombinant RALY
Incubate with viral proteins (e.g., 3C protease)
Analyze modification status by Western blotting
These approaches would extend current understanding of how FMDV 3C protease targets RALY for degradation via the ubiquitin-proteasome pathway .
When troubleshooting RALY antibody Western blotting:
Weak signal problems:
Increase primary antibody concentration (try 1:250 instead of 1:1,000)
Extend primary antibody incubation (overnight at 4°C)
Use more sensitive detection reagents
Increase protein loading
Optimize transfer conditions for the 38 kDa range
Non-specific bands:
Increase blocking stringency (5% BSA instead of milk)
Use more stringent washing (higher salt in TBST)
Reduce primary antibody concentration
Include appropriate positive control (RALY-overexpressing sample)
Include negative control (RALY-knockdown sample)
Research with RALY antibodies has successfully detected both endogenous RALY and overexpressed Flag-RALY in various experimental conditions, demonstrating their reliability when properly optimized .
To validate RALY antibody specificity:
Genetic approaches:
Overexpression validation:
Transfect cells with Flag-RALY expression construct
Perform parallel detection with anti-RALY and anti-Flag antibodies
Confirm co-localization of signals
Cross-species reactivity testing:
Immunoprecipitation-Western validation:
Immunoprecipitate with RALY antibody
Perform Western blotting on precipitate with a different RALY antibody
Confirm specific enrichment of RALY protein
These validation approaches ensure experimental results accurately reflect RALY biology rather than non-specific antibody interactions.
For accurate quantification of RALY mRNA levels:
| No. | Primer name | Sequence (5′−3′) | Application |
|---|---|---|---|
| 1 | RALY-Fwd | [Sequence would be based on specific research needs] | qPCR |
| 2 | RALY-Rev | [Sequence would be based on specific research needs] | qPCR |
| 3 | hGAPDH-Fwd | GTCCATGCCATCACTGCCACCCAG | Control |
| 4 | hGAPDH-Rev | GCTGTTGAAGTCACAGGACACAAC | Control |
| 5 | hRPS16-Fwd | TCGCAGCCATGCCGTCCAAGGGT | Control |
| 6 | hRPS16-Rev | TCATTAAGATGGGCTCATCGGT | Control |
Protocol:
Extract total RNA using TRIzol Reagent
Perform reverse transcription to generate cDNA
Set up qPCR reactions with SYBR Green or probe-based detection
Include no-template and RT-minus controls
Use the comparative Ct method (2^-ΔΔCt) for relative quantification
Normalize to multiple reference genes (e.g., GAPDH and RPS16)
This approach enables accurate quantification of RALY expression changes during experimental manipulations or viral infection.
The TCID50 (Tissue Culture Infectious Dose 50%) assay protocol for correlating RALY expression with viral replication:
Transfect cells with RALY siRNA or overexpression plasmid
After appropriate incubation (36-48h for knockdown, 24h for overexpression), infect with virus (MOI=1)
Collect cells and supernatant at various timepoints post-infection
Freeze-thaw samples three times to release virions
Prepare serial dilutions of each sample
Add dilutions to 96-well plates (8 wells per dilution, 100 μL per well)
Add 100 μL of BHK-21 cell suspension (1.5 × 10^6 cells/mL) to each well
Incubate at 37°C, 5% CO2 for approximately 70 hours
Count wells showing cytopathic effects
This assay has demonstrated that RALY knockdown significantly increases viral titers while overexpression decreases them, confirming RALY's antiviral function in a quantitative manner .
Future research applications of RALY antibodies could include:
Comparative virus studies:
Apply established RIP, IP, and Western blotting protocols to diverse virus families
Compare RALY binding to IRES elements from different viruses
Evaluate RALY degradation by various viral proteases
Mechanism dissection:
Use RALY mutants and deletion constructs to map functional domains
Identify specific amino acids required for antiviral activity
Investigate RALY post-translational modifications across virus infections
Therapeutic development:
Screen for compounds that stabilize RALY against viral degradation
Develop peptide mimetics of RALY's RNA-binding domain
Test gene therapy approaches to deliver degradation-resistant RALY
In vivo infection models:
Use RALY antibodies for tissue immunohistochemistry in infected animals
Compare RALY levels and distribution across tissues during infection
Correlate with viral load and pathology
These approaches would expand our understanding of RALY's potentially broad antiviral activities beyond FMDV .
Understanding the dual role of RALY requires:
Comparative RIP-seq analysis:
Immunoprecipitate RALY from mock and infected cells
Perform RNA sequencing of bound transcripts
Compare cellular vs. viral RNA binding profiles
Cellular impact assessment:
Monitor changes in cellular RNA processing during RALY recruitment to viral RNAs
Identify cellular processes affected by RALY sequestration
Determine whether viral targeting of RALY serves purposes beyond neutralizing antiviral activity
Evolutionary analysis:
Compare RALY sequences across species with differential viral susceptibility
Identify positively selected residues that may indicate virus-host coevolution
Test chimeric RALY proteins for species-specific antiviral activity
This research would help determine whether RALY's antiviral function evolved specifically as a host defense mechanism or represents viral exploitation of RALY's normal cellular functions in RNA metabolism and translation regulation .