RANBP10 Antibody

What is RANBP10 and why is it important in research?

RANBP10 is a cytoplasmic guanine nucleotide exchange factor that shares high sequence similarity to MET-interacting protein RANBP9. It functions through interactions with several proteins, including MET, RAN, YPEL5, Protein Kinase C (PKC), and β1-tubulin . Research significance stems from its roles in cell cycle regulation, spindle assembly, transcriptional control, and disease processes. RANBP10 is emerging as an important research target due to its overexpression in several cancer types, including glioblastoma, prostate cancer, and other malignancies . Additionally, it plays critical roles in platelet function and thrombus stability, making it relevant for hematological research .

What types of RANBP10 antibodies are available for research applications?

Several RANBP10 antibodies are commercially available with different specifications:

Researchers should note that due to the existence of a paralog named RANBP10 with extensive protein similarity to RANBP9, there are limitations in antibody specificity and affinity that should be considered when selecting appropriate reagents .

What is the recommended dilution range for RANBP10 antibodies in different applications?

Based on validated protocols, the following dilution ranges are recommended:

It is strongly recommended to titrate antibodies in each experimental system to obtain optimal results, as the performance can be sample-dependent .

How should I optimize Western blot detection of RANBP10?

For optimal Western blot detection of RANBP10:

• Sample preparation: Use appropriate lysis buffers containing protease inhibitors to prevent degradation of RANBP10 (67-70 kDa).

• Protein loading: Load 20-50 μg of total protein per lane depending on RANBP10 expression levels in your sample.

• SDS-PAGE conditions: Use 8-10% polyacrylamide gels for optimal separation of RANBP10.

• Transfer conditions: Transfer to PVDF or nitrocellulose membranes at 100V for 60-90 minutes in standard transfer buffer.

• Blocking: Block with 5% non-fat milk or BSA in TBST (PBS with 0.02% sodium azide and 50% glycerol pH 7.3 is commonly used in storage buffers) .

• Antibody dilution: Dilute primary RANBP10 antibody at 1:500-1:1000 in blocking buffer and incubate overnight at 4°C .

• Positive controls: Include known RANBP10-expressing cells (MCF-7, LNCaP cells, mouse brain tissue) as positive controls .

• Troubleshooting: When encountering low signal-to-noise ratios, optimizing blocking conditions or using alternative antibodies may be necessary, as some commercially available αRANBP9 antibodies have limited detection power .

What protocols are recommended for immunohistochemical detection of RANBP10?

For immunohistochemical detection of RANBP10:

• Tissue preparation: Fix tissues in 10% formalin, process routinely, and embed in paraffin.

• Sectioning: Cut 4-μm-thick sections.

• Deparaffinization: Dewax in xylene and rehydrate through graded ethanol solutions.

• Antigen retrieval: Heat tissue sections at 96-98°C for 25 minutes in citrate solution (10 mmol/L, pH 6.0) or use TE buffer (pH 9.0) as an alternative .

• Endogenous peroxidase blocking: Immerse sections in methanol with 0.3% hydrogen peroxide for 15 minutes.

• Antibody dilution: Use RANBP10 antibody at 1:20-1:200 dilution and incubate at 4°C overnight .

• Secondary antibody: Incubate with horseradish peroxidase-labeled secondary antibody for 30 minutes.

• Visualization: Use 3,3′-Diaminobenzidine (DAB) as the chromogen and hematoxylin as the nuclear counterstain.

• Positive tissue controls: Include human heart tissue or human hepatocirrhosis tissue as positive controls .

How can I perform immunoprecipitation using RANBP10 antibodies?

For successful immunoprecipitation of RANBP10:

• Lysate preparation: Extract total proteins using appropriate lysis buffers containing protease inhibitors.

• Pre-clearing: Incubate 1 mg of total protein extracts with Protein A/G Plus Agarose for 1 hour at 4°C to reduce non-specific binding.

• Antibody incubation: After centrifugation, collect the supernatant and incubate with 5 μg of RANBP10 antibody overnight at 4°C, or use resin-conjugated antibodies (e.g., αHA-Agarose antibody for tagged RANBP10) .

• Washing: Wash the immunoprecipitates thoroughly with cold lysis buffer.

• Elution and analysis: Elute precipitated proteins and analyze by Western blot.

• Detection of interacting partners: Probe for known RANBP10-interacting proteins such as members of the CTLH complex (Gid8, Muskelin, Maea, Armc8, Wdr26, Rmnd5A) or its paralog RanBP10 .

The advantage of using epitope-tagged RANBP10 (such as the RanBP9-TT mouse model with V5-HA tags) is increased detection sensitivity and specificity compared to using RANBP10-specific antibodies, especially for immunoprecipitation experiments .

How can RANBP10 antibodies be used to study its role in cancer progression?

RANBP10 antibodies are valuable tools for investigating its roles in cancer progression through multiple approaches:

• Expression profiling: Use immunohistochemistry and Western blotting to assess RANBP10 expression levels in tumor vs. normal tissues. Studies have shown RANBP10 overexpression in GBM correlates with poor patient survival .

• Functional studies: Combine RANBP10 antibodies with knockdown or overexpression experiments to validate protein modulation. For example:

  • In GBM studies, researchers used shRANBP10 constructs (sequences: CAAGTTGGTGATAGCTTATTA, AGATTGTGGACGCCAACTTTG, CAAAGGAAGAGATGGTTACAT) to downregulate RANBP10 expression and observed inhibition of cell proliferation, migration, invasion, and tumor growth .

• Mechanistic investigations: Use co-immunoprecipitation with RANBP10 antibodies to identify interacting partners in cancer cells. In GBM, RANBP10 was shown to suppress FBXW7 promoter activity and increase c-Myc protein stability .

• Prognostic marker evaluation: Correlate RANBP10 expression data from immunohistochemistry with patient outcomes. In GBM patients, high RANBP10 expression was closely linked to poor survival .

• Therapeutic target validation: Use RANBP10 antibodies to confirm target engagement in preclinical models testing potential therapeutic interventions against RANBP10-dependent cancer processes.

What approaches can be used to study RANBP10's role in microtubule organization and platelet function?

To investigate RANBP10's role in microtubule dynamics and platelet function:

• Colocalization studies: Use immunofluorescence with RANBP10 antibodies alongside microtubule markers to examine colocalization in megakaryocytes and platelets.

• Ultrastructural analysis: Combine immunogold labeling with electron microscopy to visualize RANBP10 localization at the nanoscale level.

• Live-cell imaging: Use GFP-tagged RANBP10 constructs validated by antibody detection to track dynamic changes during platelet activation.

• Functional assays: Compare wild-type and RANBP10-null platelets using:

  • Platelet aggregation testing

  • Granule release assays

  • Clot retraction measurements

  • Intravital microscopy to assess thrombus formation and stability in vivo

• Biochemical interactions: Immunoprecipitate RANBP10 and probe for co-precipitation of β1-tubulin and other cytoskeletal components.

Research has shown that RanBP10-null mice display a severe bleeding phenotype in tail bleeding assays and impaired thrombus stability in vivo. The mechanism involves altered microtubule equilibrium, with a delayed contraction of the circumferential microtubule coil in response to agonists, attenuating granule centralization and release .

How can genetic engineering approaches complement antibody-based detection of RANBP10?

Genetic engineering approaches can overcome limitations of antibody-based detection:

• Epitope tagging: The RanBP9-TT mouse model demonstrates how adding V5-HA tags to endogenous RANBP10 enhances detection sensitivity. This strategy:

  • Increases detection power with commercially available αV5/αHA antibodies

  • Improves signal-to-noise ratio compared to conventional RANBP10 antibodies

  • Allows for unequivocal detection by both IHC and WB

  • Enables reliable immunoprecipitation studies

• CRISPR/Cas9 engineering: Using CRISPR/Cas9 for tagging endogenous RANBP10 provides advantages:

  • No "scarring" of the edited allele beyond the intended mutation

  • Preservation of endogenous expression regulation

  • Compatibility with various genetic backgrounds

• Knockout validation: Generating RANBP10 knockout models provides critical negative controls for antibody specificity assessment.

• Reporter systems: Creating fluorescent protein fusions can complement antibody detection for live-cell imaging and spatiotemporal studies.

In research comparing detection methods, αV5 tag-based detection showed superior sensitivity and specificity (lower background) compared to both αHA and αRanBP9-specific antibodies, particularly in liver samples where conventional antibodies yielded barely detectable signals .

What are common challenges in RANBP10 detection and how can they be overcome?

Researchers working with RANBP10 antibodies frequently encounter these challenges:

• Limited specificity: Due to high sequence similarity with paralog RANBP9, specificity issues are common.
  Solution: Use genetic knockouts or knockdowns as negative controls; consider using epitope-tagged RANBP10 for increased specificity.

• Low detection sensitivity: Many commercial antibodies show weak signals, especially in WB applications.
  Solution: Increase protein loading; extend primary antibody incubation time (overnight at 4°C); use signal enhancement methods; consider more sensitive detection systems.

• High background in IHC/IF: Non-specific binding creates interpretation difficulties.
  Solution: Optimize blocking conditions (5% BSA or non-fat milk); increase antibody dilution; include appropriate negative controls; use more stringent washing procedures.

• Cross-reactivity concerns: Antibodies may detect both RANBP9 and RANBP10.
  Solution: Perform validation using RANBP10-specific knockout tissues; use epitope tags as demonstrated in the RanBP9-TT mouse model .

• Inconsistent results across applications: An antibody working well for WB may fail in IHC.
  Solution: Validate antibodies specifically for each application; optimize protocols individually for different applications; consider using application-specific antibodies.

How should I validate RANBP10 antibody specificity for my research?

Thorough validation of RANBP10 antibodies is essential:

• Genetic knockout/knockdown controls: Test antibodies on samples with reduced or eliminated RANBP10 expression:

  • Use RANBP10 siRNA/shRNA-treated cells

  • Employ CRISPR/Cas9-engineered RANBP10 knockout cell lines

  • Utilize tissues from RANBP10 knockout mouse models

• Paralog specificity assessment: Confirm specificity against the RANBP9 paralog:

  • Test on cells overexpressing either RANBP9 or RANBP10

  • Compare expression patterns with known differential tissue distribution

  • Perform side-by-side testing with RANBP9-specific antibodies

• Multiple antibody comparison: Use different antibodies recognizing distinct epitopes:

  • Compare staining patterns across several commercial antibodies

  • Correlate findings with mRNA expression data

  • Verify expected molecular weight (67-70 kDa for RANBP10)

• Tagged protein controls: Express epitope-tagged RANBP10 and detect with both tag-specific and RANBP10-specific antibodies:

  • Use V5-HA tagged RANBP10 as demonstrated in the RanBP9-TT mouse model

  • Compare detection sensitivity and specificity

• Mass spectrometry confirmation: Perform mass spectrometry analysis of immunoprecipitated proteins to confirm antibody specificity.

When and how should I consider using epitope tagging instead of direct RANBP10 antibody detection?

Consider epitope tagging when:

• Facing detection limitations: When commercial RANBP10 antibodies show poor performance, epitope tagging can dramatically improve detection:

  • The RanBP9-TT mouse model demonstrates superior detection using V5-HA tags compared to conventional RANBP10 antibodies

  • Particularly beneficial for tissues with naturally low RANBP10 expression (e.g., liver)

• Requiring highly specific immunoprecipitation: Epitope tags typically enable cleaner and more efficient immunoprecipitation:

  • Allows pull-down of protein complexes with minimal background

  • Facilitates detection of novel interaction partners (e.g., Nucleolin identified through RanBP9-TT mouse model)

• Performing multi-parameter detection: When co-staining with antibodies from the same host species would cause cross-reactivity issues.

Implementation approaches:

• In vitro overexpression: Transfect cells with tagged RANBP10 constructs

  • Suitable for preliminary studies

  • May cause artifactual effects due to non-physiological expression levels

• CRISPR knock-in strategy: Engineer endogenous tagging

  • Preserves natural expression patterns and levels

  • Avoids overexpression artifacts

  • More technically challenging

• Animal model generation: Create knock-in animals as demonstrated with the RanBP9-TT mouse model

  • Enables in vivo studies with improved detection

  • Allows tissue-specific analysis

  • Requires significant resources and expertise

How can RANBP10 antibodies be used to investigate its role in neurodegenerative diseases?

RANBP10 has emerging roles in neurodegenerative conditions, including Huntington's disease (HD), with antibody-based detection being crucial for research:

• Protein aggregation studies: RANBP10 influences huntingtin (HTT) aggregation:

  • When RANBP10 is knocked down, less aggregated HTT is observed

  • RANBP10 overexpression increases HTT aggregation

  • R6/2 HD transgenic mice show increased RANBP10 expression

Research applications include:

• Expression profiling: Use immunohistochemistry with RANBP10 antibodies to assess expression changes in neurodegenerative disease models and patient samples.

• Protein-protein interaction studies: Employ co-immunoprecipitation to investigate interactions between RANBP10 and disease-related proteins like huntingtin.

• Therapeutic target validation: Use RANBP10 antibodies to monitor target engagement and effectiveness of RANBP10-directed interventions.

• Biomarker development: Investigate whether RANBP10 levels or post-translational modifications could serve as disease biomarkers.

• Mechanistic investigations: Combine RANBP10 antibody detection with other methods to elucidate its role in neuronal function and disease pathogenesis.

What role does RANBP10 play in transcriptional regulation and how can this be studied?

RANBP10 functions as a transcriptional coactivator, with significant implications for gene expression:

• Androgen receptor (AR) coactivation:

  • RANBP10 enhances ligand-dependent transcriptional activity of AR

  • Forms a complex with AR

  • High expression in AR-positive prostate cancer cells

  • Forms homo-oligomers or hetero-oligomers with RanBPM to enhance AR transactivation

• Viral gene regulation:

  • Acts as a cellular transcriptional coactivator for herpes simplex virus (HSV)

  • Synergistically promotes viral gene expression with ICP0

  • Regulates chromatin remodeling of the HSV-1 genome

• FBXW7 transcriptional regulation:

  • Suppresses FBXW7 promoter activity in glioblastoma

  • Indirectly increases c-Myc protein stability through this mechanism

Research approaches using antibodies:

• Chromatin immunoprecipitation (ChIP): Use RANBP10 antibodies to identify genomic binding regions.

• Transcription factor complex analysis: Immunoprecipitate RANBP10 to identify associated transcription factors.

• Luciferase reporter assays: Combine with RANBP10 antibody validation to correlate protein expression with functional effects.

• Co-immunoprecipitation (Co-IP): Identify interaction partners involved in transcriptional regulation.

What advances in antibody technology might improve future RANBP10 research?

Emerging antibody technologies promise to enhance RANBP10 research:

• Single-domain antibodies (nanobodies):

  • Smaller size allows better tissue penetration

  • Can access epitopes inaccessible to conventional antibodies

  • Potential for improved specificity against RANBP10 vs. RANBP9

• Recombinant antibody fragments:

  • Consistent production without batch variability

  • Engineered for specific applications

  • Potential for higher specificity through directed evolution

• Proximity labeling approaches:

  • Antibody-enzyme fusions that catalyze biotinylation of nearby proteins

  • BioID or APEX2 fusions to study RANBP10 proximal interactome

  • Enhanced detection of transient interactions

• Intrabodies:

  • Antibodies designed for intracellular expression

  • Allow real-time tracking of RANBP10 in living cells

  • Potential for functional modulation through specific domain targeting

• Multiplexed detection systems:

  • Simultaneous detection of RANBP10 with multiple interacting partners

  • Mass cytometry or multiplexed immunofluorescence for comprehensive analysis

  • Better understanding of context-dependent RANBP10 functions

• Optogenetic antibody systems:

  • Light-controlled antibody-based detection or modulation

  • Spatiotemporal control of RANBP10 function

  • Investigation of dynamic RANBP10-dependent processes

These technologies could help overcome current limitations in RANBP10 research related to antibody specificity, sensitivity, and functional analysis capabilities.