RAVER2 Antibody

What is RAVER2 and what cellular functions does it regulate?

RAVER2 functions as a splicing-related factor that is overexpressed in medullary thymic epithelial cells (mTECs). It promotes alternative splicing events (ASEs) specifically in transcripts of Aire-neutral genes while leaving Aire-sensitive genes unaffected. RAVER2 is dependent on H3K36me3 histone marks and appears to interact with PTB (polypyrimidine tract-binding protein) to enhance ASE inclusion for transcripts of genes with H3K36me3 enrichment . RAVER2's full name is Ribonucleoprotein PTB-binding 2, also known as Protein raver-2 or KIAA1579 . Its role is particularly important in thymic epithelium, where it shows preferential expression compared to other tissue epithelia .

What applications are validated for RAVER2 antibodies in research?

RAVER2 antibodies have been validated for multiple experimental applications in research settings. The most common applications include Western Blot (WB), Immunohistochemistry (IHC), Immunofluorescence (IF), Immunocytochemistry (ICC), and Immunoprecipitation (IP) . These techniques enable researchers to investigate RAVER2 expression, localization, and interactions with other proteins involved in RNA splicing mechanisms. It's important to note that these antibodies are restricted to research use only and not intended for diagnostic procedures .

How does RAVER2 function in the context of alternative splicing?

RAVER2 functions as a potent modulator of the splicing activity of PTB (polypyrimidine tract-binding protein). In mTECs, RAVER2 promotes the inclusion of alternative splicing events (ASEs) specifically in transcripts of Aire-neutral genes, while transcripts of Aire-sensitive genes escape its effect . This selective mechanism is linked to the presence of H3K36me3 histone marks, which are depleted at Aire-sensitive genes. The function of RAVER2 has been demonstrated through knockdown experiments showing that reducing RAVER2 expression significantly reduces the levels of ASE inclusion imbalance for Aire-neutral genes while having no effect on Aire-sensitive genes .

What are the optimal conditions for using RAVER2 antibodies in Western blot applications?

When designing Western blot experiments with RAVER2 antibodies, researchers should consider several methodological factors. Based on typical protocols for rabbit monoclonal antibodies like the RAVER2 antibody (Cat#RAA00467), optimal dilutions typically range from 1:500 to 1:2000 depending on the specific antibody sensitivity and target abundance . For protein extraction, standard lysis buffers containing protease inhibitors are recommended to prevent degradation of RAVER2 protein.

When detecting RAVER2 protein, which has a molecular weight corresponding to its gene ID 7082 and accession number Q9HCJ3, a 7-10% SDS-PAGE gel is typically suitable . For validation purposes, researchers should include positive controls such as thymic epithelial cell lysates where RAVER2 is known to be highly expressed, and negative controls such as tissues with low RAVER2 expression or knockdown samples.

How can researchers effectively design RAVER2 knockdown experiments to study its function?

Based on published methodologies, effective RAVER2 knockdown experiments can be designed using shRNA approaches. Following the protocol described in the literature, researchers should:

• Design or obtain shRNAs targeting RAVER2 (example primer sequences: forward primer: AACCAGAAGACACCGCAGAG; reverse: TCTCCCAAGAGTGAAGTCTGATT)

• Clone the shRNAs into a vector expressing GFP as a marker of transduction

• Generate concentrated lentiviruses encoding these shRNAs

• Infect target cells (e.g., mTECs in a 3D organotypic system)

• Sort GFP+ cells 3-5 days post-infection to isolate cells with successful transduction

• Verify knockdown efficiency through qPCR (using GAPDH for normalization)

• Perform RNA-seq experiments to assess the impact on alternative splicing events

This approach has demonstrated significant reduction of RAVER2 expression to 10-20% of control levels, allowing for the assessment of its role in alternative splicing regulation .

What controls should be included when studying RAVER2's role in alternative splicing?

When investigating RAVER2's role in alternative splicing, several essential controls should be incorporated:

• Knockdown controls: Include both negative controls (e.g., shRNA targeting LacZ) and multiple RAVER2-targeting shRNAs to control for off-target effects

• Gene expression controls: Measure expression levels of other splicing factors, particularly PTB, which interacts with RAVER2, to ensure observed effects are specifically due to RAVER2 knockdown

• Tissue-specific controls: Compare alternative splicing events between thymic epithelial cells (where RAVER2 is highly expressed) and peripheral tissues with lower RAVER2 expression

• Epigenetic controls: Assess H3K36me3 status at genes of interest, as this histone mark is crucial for RAVER2 recruitment

• Aire-dependent controls: Include both Aire-sensitive and Aire-neutral genes in the analysis to demonstrate the specificity of RAVER2's effect

How does RAVER2 regulation of alternative splicing impact central tolerance mechanisms?

RAVER2's regulation of alternative splicing has significant implications for central tolerance mechanisms. The research indicates that Aire-sensitive genes, which are critical for central tolerance, escape Raver2-induced alternative splicing due to depletion of H3K36me3 marks, resulting in transcripts with fewer alternative splicing events (ASEs) .

This finding has profound immunological significance: the weak ASE inclusion in Aire-induced transcripts means that not all peripheral tissue-specific ASEs are represented in medullary thymic epithelial cells (mTECs). Consequently, T cells reactive against peptides derived from these thymus-excluded ASEs may escape negative selection and enter the periphery, potentially causing autoimmune reactions . This mechanism explains why complementary peripheral tolerance mechanisms, such as regulatory T cells (Tregs), are necessary to maintain tolerance against the full spectrum of self-antigens. The study suggests that Tregs selected against peptides from constitutive exons of Aire-sensitive genes in mTECs may suppress autoimmune responses triggered against immunogenic ASE-derived peptides .

What methodologies are most effective for studying RAVER2 interactions with other splicing factors?

To effectively study RAVER2 interactions with other splicing factors, particularly PTB, several complementary methodologies can be employed:

• Co-immunoprecipitation (Co-IP): Using RAVER2 antibodies for immunoprecipitation followed by detection of interacting partners like PTB. This application has been validated for RAVER2 antibodies .

• Proximity ligation assays (PLA): For visualizing and quantifying protein-protein interactions in situ, allowing researchers to detect close proximity between RAVER2 and other splicing factors within the cellular context.

• RNA immunoprecipitation (RIP): To identify RNA targets bound by RAVER2-containing complexes, providing insights into which transcripts are regulated by RAVER2 and associated splicing factors.

• Chromatin immunoprecipitation (ChIP): For studying the association of RAVER2 with H3K36me3-marked genomic regions, as this histone mark is crucial for RAVER2 recruitment .

• Functional validation through knockdown experiments: Knock down RAVER2, PTB, or both, and assess the impact on alternative splicing patterns through RNA-seq analysis .

How can researchers investigate the relationship between H3K36me3 marks and RAVER2 recruitment to splicing sites?

The relationship between H3K36me3 histone marks and RAVER2 recruitment can be investigated using a multi-faceted approach:

• ChIP-seq for H3K36me3: First, perform chromatin immunoprecipitation followed by sequencing to map H3K36me3 distribution across the genome, particularly at Aire-sensitive versus Aire-neutral genes .

• RNA-IP or CLIP-seq for RAVER2: Use these techniques to identify which transcripts and specific RNA sequences are bound by RAVER2.

• Combined knockdown approaches: Knockdown SETD2 (the methyltransferase responsible for H3K36me3) and assess the impact on RAVER2 binding and splicing outcomes .

• Correlation analyses: Correlate H3K36me3 levels with RAVER2 binding and alternative splicing event inclusion across the genome.

• Targeted mutagenesis: Create reporter constructs with or without H3K36me3-enriched regions to test the direct impact on RAVER2 recruitment.

Research has shown that H3K36me3 profiling reveals depletion of this mark at Aire-sensitive genes, supporting a mechanism preceding Aire expression that leads to transcripts with low ASEs that escape Raver2-induced alternative splicing .

What are common issues encountered with RAVER2 antibodies in immunofluorescence and how can they be addressed?

When using RAVER2 antibodies for immunofluorescence (IF) applications, researchers may encounter several technical challenges:

• High background signal: This can be addressed by:

  • Optimizing antibody dilution (typically starting with 1:100-1:500 for IF)

  • Extending blocking time with 5% BSA or normal serum

  • Including additional washing steps with PBS containing 0.1-0.3% Tween-20

  • Using Sudan Black B (0.1-0.3%) to reduce autofluorescence, particularly in tissues with high lipid content

• Weak or absent signal: To improve signal detection:

  • Try different fixation methods (4% paraformaldehyde vs. methanol)

  • Optimize antigen retrieval methods (heat-induced vs. enzymatic)

  • Increase antibody incubation time (overnight at 4°C)

  • Use signal amplification systems such as tyramide signal amplification

• Non-specific binding: To enhance specificity:

  • Pre-adsorb the antibody with non-specific proteins

  • Use more stringent washing conditions

  • Include appropriate positive controls (thymic epithelial cells) and negative controls (RAVER2 knockdown samples)

How can discrepancies in RAVER2 detection between different experimental techniques be reconciled?

Discrepancies in RAVER2 detection between techniques such as Western blot, immunohistochemistry, and immunofluorescence may occur for several reasons:

• Epitope accessibility: Different techniques expose different epitopes, with denatured proteins in Western blot versus partially preserved structures in IHC/IF. To address this:

  • Use antibodies targeting different epitopes of RAVER2

  • Compare results from monoclonal versus polyclonal antibodies

  • Try different fixation and permeabilization methods for IHC/IF

• Expression level detection limits: Western blot may detect lower expression levels than imaging techniques. Solutions include:

  • Use concentration steps for dilute samples in Western blot

  • Employ signal amplification in imaging techniques

  • Quantify signal intensity across methods and normalize to appropriate controls

• Splice variant detection: If discrepancies persist, investigate whether alternative splice variants of RAVER2 exist that may be detected differentially:

  • Design primers to detect potential splice variants by RT-PCR

  • Use antibodies targeting different regions of RAVER2

  • Compare results with RNA-seq data to identify potential isoforms

What approaches can overcome challenges in studying RAVER2 in primary thymic epithelial cells?

Studying RAVER2 in primary thymic epithelial cells presents several challenges due to their scarcity and complexity. Based on published methodologies, effective approaches include:

• 3D organotypic culture systems: As described in the literature, researchers can use a 3D organotypic system to seed medullary- and MHCII-enriched TECs and maintain them in culture for 5 days . This system allows for:

  • Lentiviral transduction for gene knockdown

  • Assessment of gene expression changes

  • Analysis of splicing alterations

• Single-cell approaches: Given the heterogeneity of thymic epithelial cells:

  • Use full-length single-cell RNA-seq to enable splicing analyses at the single-cell level

  • Correlate RAVER2 expression with alternative splicing patterns in individual cells

  • Study cell-to-cell variability in splicing regulation

• Enrichment strategies: To overcome the scarcity of these cells:

  • Use cell sorting based on specific surface markers (e.g., MHCII)

  • Add RankL to culture media to prevent excessive mTEChi mortality and/or de-differentiation

  • Implement careful timing for analysis after isolation (e.g., 3 days for knockdown verification, 5 days for splicing analysis)

How might RAVER2 function be studied in autoimmune disease models?

Future research on RAVER2 function in autoimmune disease models could explore several promising directions:

• RAVER2 knockout models: With the recent availability of RAVER2 knockout cryopreserved embryos through the Knockout Mouse Project, researchers can now assess:

  • The effect of RAVER2 deletion on the diversity of autoreactive T cells

  • Susceptibility to spontaneous or induced autoimmune conditions

  • Changes in thymic selection processes in the absence of RAVER2

• Identification of autoreactive T cells: Using MHC tetramers carrying peptides from thymus-excluded ASEs of Aire-dependent genes to:

  • Evaluate the direct impact of weak ASE inclusion on central tolerance

  • Track the fate of T cells reactive to these specific epitopes

  • Assess whether these T cells contribute to autoimmune pathology

• Therapeutic targeting: Investigate whether modulating RAVER2 activity could:

  • Enhance negative selection of potentially autoreactive T cells

  • Reduce autoimmune responses in established disease models

  • Serve as a novel approach to autoimmune disease treatment

What novel techniques might improve detection and functional analysis of RAVER2?

Emerging technologies and approaches could significantly enhance RAVER2 detection and functional analysis:

• Advanced imaging techniques:

  • Super-resolution microscopy to visualize RAVER2 localization at individual splicing sites

  • Live-cell imaging with tagged RAVER2 to monitor its dynamics during splicing events

  • Multiplex imaging to simultaneously track RAVER2, PTB, and other splicing factors

• CRISPR-based approaches:

  • CRISPR activation or inhibition systems to modulate RAVER2 expression with greater temporal control

  • CRISPR base editing to introduce specific mutations in RAVER2 to study structure-function relationships

  • CRISPR screens to identify novel factors that interact with RAVER2 in splicing regulation

• Computational methods:

  • Machine learning algorithms to predict RAVER2 binding sites based on RNA sequence and structure

  • Integrative analysis of transcriptomic, epigenomic, and proteomic data to build comprehensive models of RAVER2 function

  • Network analysis to position RAVER2 within the broader context of splicing regulation

How might understanding RAVER2's role in alternative splicing contribute to therapeutic approaches for autoimmune disorders?

Understanding RAVER2's role in alternative splicing could lead to novel therapeutic approaches for autoimmune disorders through several mechanisms:

• Targeted modulation of alternative splicing: By understanding how RAVER2 regulates alternative splicing in Aire-neutral genes, researchers might develop approaches to:

  • Enhance presentation of tissue-specific ASEs in the thymus

  • Improve negative selection of potentially autoreactive T cells

  • Reduce the escape of T cells reactive against thymus-excluded ASEs

• Complementary tolerance mechanisms: The research suggests that Tregs selected against peptides from constitutive exons may suppress autoimmune responses against ASE-derived peptides. This knowledge could lead to:

  • Therapeutic strategies enhancing Treg development or function

  • Targeted expansion of Tregs specific for autoantigens derived from alternatively spliced exons

  • Novel combination therapies addressing both central and peripheral tolerance mechanisms

• Biomarker development: The patterns of alternative splicing regulated by RAVER2 could serve as:

  • Diagnostic markers for predisposition to autoimmunity

  • Indicators of disease progression or severity

  • Predictors of response to specific immunomodulatory therapies

The findings that Aire-dependent immunological tolerance involves both mTEChi-dependent negative selection and complementary peripheral mechanisms suggests that targeting multiple aspects of this system could provide more effective treatments for autoimmune disorders .