ranbp10 Antibody

What is RANBP10 and what are its primary cellular functions?

RANBP10 (RAN binding protein 10) is a ubiquitously expressed and evolutionarily conserved protein that functions primarily as a RAN-GTP exchange factor (GEF) for RAN GTPase. It is predominantly localized in the cytoplasm and cytosol, with some nuclear presence . RANBP10 serves multiple cellular functions, including:

• Acting as an adapter protein to couple membrane receptors to intracellular signaling pathways

• Functioning as a core component of the CTLH E3 ubiquitin-protein ligase complex that mediates ubiquitination and proteasomal degradation of transcription factor HBP1

• Enhancing dihydrotestosterone-induced transactivation activity of androgen receptor (AR) and dexamethasone-induced transactivation of NR3C1

• Playing essential roles in hemostasis and maintaining microtubule dynamics related to platelet shape and function

Recent studies have identified significant roles for RANBP10 in cancer progression, particularly in glioblastoma, where it promotes cell proliferation, migration, invasion, and tumor growth through regulation of the FBXW7-c-Myc axis .

How are RANBP10 antibodies typically generated for research applications?

RANBP10 antibodies used in research are predominantly generated through peptide immunization strategies. The process typically involves:

• Selection of immunogenic epitopes: Researchers identify regions of RANBP10 that are likely to elicit strong immune responses, often targeting amino acid sequences that are surface-exposed and unique to RANBP10

• Peptide synthesis: Short peptide sequences (typically 15-20 amino acids) corresponding to these regions are synthesized

• Host immunization: The synthesized peptides are injected into host animals (commonly rabbits) to stimulate antibody production

• Antibody purification: The resulting antisera are purified through affinity chromatography using columns prepared with the peptide immunogen

For example, commercial RANBP10 antibodies are often raised against synthetic peptides derived from specific regions of human RANBP10, such as the amino acid range 353-403 or 380-430 . These antibodies are typically produced as polyclonal IgG antibodies in rabbit hosts and purified from rabbit antiserum using epitope-specific immunogen affinity chromatography .

What molecular weight should I expect when detecting RANBP10 using antibodies in Western blot?

When using RANBP10 antibodies in Western blot applications, researchers should expect to observe a band corresponding to approximately 68 kDa . This observed molecular weight aligns with the calculated molecular weight of RANBP10, which is approximately 67.257 kDa based on its amino acid sequence .

It's important to note that the apparent molecular weight can vary slightly depending on:

• Post-translational modifications

• The specific cell or tissue type being analyzed

• The gel percentage and running conditions used

• The protein standards used for calibration

When performing Western blot analysis for RANBP10, it is recommended to include appropriate positive controls and molecular weight markers to accurately interpret results. Additionally, researchers should verify specificity through approaches such as knockdown/knockout validation or using multiple antibodies targeting different epitopes of RANBP10.

What are the validated applications for RANBP10 antibodies and their optimal working dilutions?

RANBP10 antibodies have been validated for multiple experimental applications, each requiring specific optimization of working dilutions:

These applications allow researchers to detect endogenous levels of RANBP10 protein across human, rat, and mouse samples . When implementing these techniques, it is advisable to perform preliminary titration experiments to determine the optimal concentration for specific experimental conditions and sample types.

For immunohistochemistry applications particularly, the protocol typically involves incubating tumor sections with primary antibodies after blocking with 3% H₂O₂ and goat serum, followed by appropriate secondary antibody incubation .

How can I validate the specificity of RANBP10 antibodies in my experimental system?

Validating antibody specificity is critical for ensuring reliable research outcomes. For RANBP10 antibodies, several complementary approaches can be implemented:

• Genetic knockdown/knockout validation:

  • Utilize shRNA-mediated knockdown of RANBP10 (verified sequences include: CAAGTTGGTGATAGCTTATTA, AGATTGTGGACGCCAACTTTG, and CAAAGGAAGAGATGGTTACAT)

  • Compare antibody signal between control and RANBP10-depleted samples using Western blot or immunofluorescence

  • A specific antibody will show significantly reduced signal in knockdown/knockout samples

• Peptide competition assay:

  • Pre-incubate the RANBP10 antibody with excess immunizing peptide

  • Apply to parallel samples alongside the non-blocked antibody

  • Specific binding will be abolished or significantly reduced in the peptide-blocked sample

• Overexpression validation:

  • Transfect cells with a tagged RANBP10 expression construct (such as HA-tagged RANBP10)

  • Perform dual detection with anti-tag antibody and the RANBP10 antibody

  • Co-localization or co-detection confirms specificity

• Molecular weight verification:

  • Confirm that the detected band appears at the expected molecular weight (approximately 68 kDa)

  • Compare with recombinant RANBP10 protein as a positive control

• Cross-reactivity assessment:

  • Test the antibody against related proteins like RANBP9

  • Verify that the antibody specifically detects RANBP10 without cross-reacting with structurally similar proteins

Implementing multiple validation strategies provides stronger evidence for antibody specificity and increases confidence in experimental results.

What is the recommended protocol for immunoprecipitation of RANBP10 protein complexes?

For effective immunoprecipitation of RANBP10 and its protein interaction partners, the following optimized protocol is recommended:

• Cell lysis and pre-clearing:

  • Harvest cells and wash twice with cold PBS

  • Lyse cells in IP buffer (50 mM Tris-HCl pH 7.4, 150 mM NaCl, 1% NP-40, 0.5% sodium deoxycholate, protease inhibitor cocktail)

  • Incubate on ice for 30 minutes with occasional mixing

  • Centrifuge at 14,000 × g for 15 minutes at 4°C

  • Pre-clear lysate with protein G beads for 1 hour at 4°C

• Antibody binding:

  • Add 2-5 μg of anti-RANBP10 antibody to 500 μg-1 mg of pre-cleared lysate

  • Incubate with gentle rotation overnight at 4°C

  • Add 30-50 μl of protein G beads and incubate for 2-4 hours at 4°C

• Washing and elution:

  • Collect beads by brief centrifugation and remove supernatant

  • Wash beads 4-5 times with IP wash buffer (IP buffer with reduced detergent concentration)

  • Elute proteins by boiling in SDS-PAGE sample buffer for 5 minutes

  • Resolve by SDS-PAGE under non-reducing conditions

• Detection of interaction partners:

  • Perform Western blot analysis using antibodies against suspected interacting proteins

  • For novel interaction discovery, samples can be analyzed by mass spectrometry

This approach has been successfully used to identify RANBP10 interactions with cellular proteins such as β-tubulin and components of the cytoskeleton . For detection of transient or weak interactions, consider using crosslinking agents like disuccinimidyl suberate (DSS) or formaldehyde before cell lysis.

How does RANBP10 contribute to glioblastoma progression at the molecular level?

RANBP10 plays a significant role in promoting glioblastoma (GBM) progression through multiple molecular mechanisms:

• Regulation of the FBXW7-c-Myc axis:

  • RANBP10 suppresses the promoter activity of FBXW7, a tumor suppressor and E3 ubiquitin ligase

  • Reduced FBXW7 expression results in increased c-Myc protein stability

  • Elevated c-Myc drives proliferation, cell cycle progression, and oncogenic programs in GBM cells

• Promotion of cellular proliferation:

  • RANBP10 knockdown significantly inhibits GBM cell proliferation as demonstrated by reduced cell viability in MTT assays

  • BrdU incorporation assays show decreased DNA synthesis in RANBP10-depleted cells

  • These effects are partially rescued by concurrent FBXW7 silencing, confirming the mechanistic link to the FBXW7-c-Myc pathway

• Enhancement of migration and invasion:

  • RANBP10 positively regulates GBM cell migration and invasion capabilities

  • Downregulation of RANBP10 significantly reduces these aggressive phenotypes

  • The migration and invasion promoting effects likely involve cytoskeletal reorganization, potentially through RANBP10's known interactions with tubulin

• Support of tumor growth in vivo:

  • Animal models demonstrate that RANBP10 downregulation inhibits tumor growth

  • This effect translates the in vitro observations to physiologically relevant contexts

  • Suggests RANBP10 as a potential therapeutic target for GBM treatment

Clinically, RANBP10 overexpression in GBM correlates with poor patient survival, highlighting its significance as both a prognostic marker and potential therapeutic target .

What methodological approaches can be used to study RANBP10's role in cancer using antibody-based techniques?

Researchers can employ several antibody-based methodological approaches to investigate RANBP10's role in cancer:

• Tissue microarray (TMA) and immunohistochemistry analysis:

  • Use RANBP10 antibodies to assess expression levels across cancer patient cohorts

  • Correlate expression with clinical parameters (survival, tumor grade, treatment response)

  • Protocol: Deparaffinize tissue sections, perform antigen retrieval, block with H₂O₂ and serum, then incubate with RANBP10 primary antibody (1:200 dilution) followed by appropriate detection system

• Co-immunoprecipitation for identifying cancer-relevant interaction partners:

  • Immunoprecipitate RANBP10 from cancer cell lysates using specific antibodies

  • Identify interacting proteins through mass spectrometry or Western blot

  • Compare interaction profiles between normal and cancer cells to identify cancer-specific interactions

  • This approach has revealed interactions between RANBP10 and cytoskeletal proteins that may influence cancer cell migration

• Chromatin immunoprecipitation (ChIP) to study transcriptional regulation:

  • Use RANBP10 antibodies to investigate if RANBP10 associates with chromatin

  • Determine if RANBP10 directly regulates FBXW7 promoter activity

  • Protocol: Cross-link cells, sonicate chromatin, immunoprecipitate with RANBP10 antibody, reverse cross-links, and analyze by qPCR or sequencing

• Proximity ligation assay (PLA) for in situ protein interaction detection:

  • Visualize and quantify RANBP10 interactions with other proteins (e.g., c-Myc) directly in cancer tissue sections

  • Provides spatial information about where these interactions occur within the tumor microenvironment

  • Particularly valuable for heterogeneous tumors like GBM

• Immunofluorescence combined with functional assays:

  • Monitor RANBP10 subcellular localization in response to treatment with potential therapeutics

  • Combine with BrdU incorporation or migration assays to correlate localization changes with functional outcomes

  • Protocol: Fix cells with 4% PFA, permeabilize, block, and incubate with RANBP10 antibody followed by fluorescent secondary antibody

These methodologies provide complementary approaches to understand RANBP10's multifaceted roles in cancer biology, from expression patterns to protein interactions and functional consequences.

How can RANBP10 expression be accurately quantified and normalized in tumor samples?

Accurate quantification and appropriate normalization of RANBP10 expression in tumor samples requires careful methodological considerations:

• Western blot quantification:

  • Extract proteins using standardized lysis buffers containing protease inhibitors

  • Load equal amounts of protein (20-50 μg) per lane, confirmed by BCA/Bradford assay

  • Include multiple housekeeping proteins for normalization (GAPDH, β-actin, and α-tubulin)

  • Use at least three biological replicates for statistical validity

  • Quantify band intensities using software like ImageJ with background subtraction

  • Calculate relative RANBP10 expression as: (RANBP10 intensity / housekeeping protein intensity)

  • For greater accuracy, use the geometric mean of multiple housekeeping proteins for normalization

• Immunohistochemistry scoring and analysis:

  • Use standardized scoring systems:

    • H-score = Σ(intensity × percentage of positive cells), range: 0-300

    • Allred score = proportion score (0-5) + intensity score (0-3), range: 0-8

  • Employ digital pathology software for objective quantification

  • Have multiple pathologists score samples independently to ensure reliability

  • Compare to both adjacent normal tissue and established control samples

• RT-qPCR for mRNA quantification:

  • Extract RNA using commercial kits designed for tumor samples

  • Verify RNA integrity by spectrophotometry and gel electrophoresis

  • Use multiple reference genes validated for the specific tumor type

  • Calculate relative expression using the 2^-ΔΔCt method

  • Primer efficiency should be between 90-110% for accurate quantification

• Controls and validation:

  • Include positive controls (cell lines with known RANBP10 expression levels)

  • Include negative controls (RANBP10 knockdown samples)

  • For clinical samples, create a standard curve using recombinant RANBP10 protein

  • Validate findings using at least two independent methodologies (e.g., combine Western blot with IHC or qPCR)

• Statistical considerations:

  • Use appropriate statistical tests based on data distribution

  • Perform power analysis to determine adequate sample size

  • Consider paired analysis for tumor vs. adjacent normal tissue

  • Control for confounding variables (patient age, tumor grade, treatment history)

By implementing these rigorous quantification and normalization protocols, researchers can generate reliable data on RANBP10 expression that can be meaningfully interpreted in the context of cancer biology and potential clinical applications.

What are the common technical challenges when working with RANBP10 antibodies and how can they be overcome?

Researchers working with RANBP10 antibodies may encounter several technical challenges. Here are the most common issues and their solutions:

• High background in immunostaining applications:

  • Challenge: Non-specific binding resulting in high background signal

  • Solutions:

    • Optimize blocking conditions (use 5% BSA or 10% normal serum from secondary antibody host species)

    • Increase washing duration and number of washes (use 5-6 washes of 5 minutes each)

    • Titrate primary antibody to determine optimal concentration

    • Include 0.1-0.3% Triton X-100 in blocking buffer to reduce hydrophobic interactions

    • Pre-absorb antibody with tissue powder from the species being examined

• Inconsistent or weak Western blot signals:

  • Challenge: Variable or faint detection of RANBP10

  • Solutions:

    • Optimize protein extraction method (use RIPA buffer with protease inhibitors)

    • Increase protein loading (up to 50-75 μg)

    • Extend primary antibody incubation (overnight at 4°C)

    • Use signal enhancement systems (e.g., biotin-streptavidin)

    • Transfer proteins to PVDF rather than nitrocellulose membranes for better protein retention

    • For phosphoprotein detection, include phosphatase inhibitors in lysis buffer

• Poor immunoprecipitation efficiency:

  • Challenge: Low yield of immunoprecipitated RANBP10

  • Solutions:

    • Pre-clear lysates thoroughly with protein G beads before adding antibody

    • Increase antibody amount (3-5 μg per 500 μg lysate)

    • Extend antibody-lysate incubation time (overnight at 4°C)

    • Use crosslinking techniques to stabilize antibody-bead complexes

    • Optimize lysis buffer conditions to preserve protein interactions

• Cross-reactivity with related proteins:

  • Challenge: Antibody detecting RANBP9 or other RAN-binding proteins

  • Solutions:

    • Validate antibody specificity using RANBP10 knockdown controls

    • Use epitope-specific antibodies targeting unique regions of RANBP10

    • Perform peptide competition assays to confirm specificity

    • Use multiple antibodies targeting different epitopes and compare results

• Epitope masking in fixed tissues:

  • Challenge: Formaldehyde fixation masking the RANBP10 epitope

  • Solutions:

    • Optimize antigen retrieval methods (try citrate buffer pH 6.0, EDTA buffer pH 9.0, or enzymatic retrieval)

    • Reduce fixation time or use alternative fixatives

    • Test multiple antibodies targeting different epitopes

    • Consider using frozen sections instead of paraffin-embedded samples

By anticipating these challenges and implementing the suggested solutions, researchers can significantly improve the quality and reliability of their RANBP10 antibody-based experiments.

How can I design experiments to distinguish between RANBP10 and other RAN-binding proteins in my research?

Designing experiments to specifically distinguish RANBP10 from other RAN-binding proteins, particularly its close homolog RANBP9, requires careful methodological approaches:

• Epitope-targeted antibody selection:

  • Choose antibodies raised against regions with minimal sequence homology to other RAN-binding proteins

  • Target the central region (amino acids 353-403) of RANBP10, which contains distinctive sequences

  • Validate antibody specificity using recombinant RANBP10 and RANBP9 proteins in parallel Western blots

• siRNA/shRNA knockdown validation strategies:

  • Design specific shRNAs targeting unique regions of RANBP10 mRNA

  • Use verified sequences such as CAAGTTGGTGATAGCTTATTA, AGATTGTGGACGCCAACTTTG, and CAAAGGAAGAGATGGTTACAT

  • Perform parallel knockdown experiments for RANBP10 and RANBP9

  • Confirm specificity of knockdown by qRT-PCR with primers designed to unique regions

  • Assess antibody reactivity in control vs. knockdown samples for both proteins

• Isoform-specific PCR detection:

  • Design PCR primers targeting unique exon junctions of RANBP10

  • Perform RT-PCR or qRT-PCR to distinguish RANBP10 from other RAN-binding proteins at the mRNA level

  • Use melting curve analysis in qPCR to confirm amplification specificity

• Differential interaction analysis:

  • Exploit known differences in protein interaction partners

  • RANBP10 specifically interacts with β-tubulin and microtubules in mature megakaryocytes and platelets

  • Perform co-immunoprecipitation followed by Western blotting for these specific interaction partners

  • Compare interaction profiles between RANBP10 and other RAN-binding proteins

• Subcellular localization assessment:

  • RANBP10 is predominantly cytoplasmic with some nuclear presence

  • Perform subcellular fractionation followed by Western blotting

  • Use confocal microscopy with dual immunofluorescence staining for RANBP10 and RANBP9

  • Quantify colocalization coefficients to determine distinct localization patterns

• Functional differentiation assays:

  • Leverage RANBP10's specific role in GBM progression through the FBXW7-c-Myc axis

  • Assess effects of selective knockdown on c-Myc stability and FBXW7 promoter activity

  • Measure functional outcomes like proliferation or migration that have been specifically linked to RANBP10

By implementing these approaches, researchers can confidently distinguish RANBP10 from other RAN-binding proteins and ensure the specificity of their experimental findings.

What are the optimal storage and handling conditions to maintain RANBP10 antibody performance over time?

Maintaining RANBP10 antibody performance requires adherence to specific storage and handling protocols:

• Long-term storage recommendations:

  • Store antibody at -20°C in manufacturer-supplied buffer (typically PBS with 50% glycerol and 0.02% sodium azide)

  • Avoid repeated freeze-thaw cycles by preparing small aliquots (10-50 μL)

  • Label aliquots with antibody information, concentration, date, and freeze-thaw count

  • Shelf-life under these conditions is typically up to one year from receipt date

• Short-term storage (working solutions):

  • Store at 4°C for up to three months

  • Add antimicrobial preservatives (0.02% sodium azide) if not already present

  • Keep in the dark to prevent photodegradation of fluorescent conjugates

  • Store in non-stick or low-protein-binding tubes to minimize antibody loss

• Thawing and handling protocol:

  • Thaw frozen aliquots on ice or at 4°C, never at room temperature or above

  • Mix gently by finger-tapping or gentle inversion, avoid vortexing

  • Centrifuge briefly (5 seconds) to collect contents at the bottom of the tube

  • Return to storage immediately after use

• Diluted antibody stability:

  • Prepare working dilutions fresh on the day of experiment when possible

  • If necessary to store diluted antibody, add carrier protein (0.5-1% BSA)

  • Store diluted solutions at 4°C for no more than 1 week

  • Monitor for signs of degradation (reduced activity, precipitation)

• Transportation conditions:

  • Transport on dry ice for frozen antibodies

  • Use cold packs (4°C) for short journeys with working solutions

  • Avoid exposure to temperatures above 4°C during transit

• Performance validation after storage:

  • Periodically test antibody performance using positive control samples

  • Compare signal intensity and background with results from fresh antibody

  • Include an antibody titration test if performance appears diminished

  • Document lot number and storage time to track potential performance changes

• Antibody rejuvenation approaches:

  • If performance decreases, try adding additional carrier protein (0.5-1% BSA)

  • Filter antibody solution through a 0.22 μm filter to remove aggregates

  • Centrifuge at 10,000g for 5 minutes to remove precipitates before use

  • For severe degradation, consider purchasing a new lot rather than extensive troubleshooting

By adhering to these storage and handling recommendations, researchers can maximize the longevity and consistent performance of RANBP10 antibodies, ensuring reliable experimental results and efficient use of resources.

What are emerging applications of RANBP10 antibodies in cancer therapeutics research?

RANBP10 antibodies are finding increasing utility in cancer therapeutics research across several innovative applications:

• Target validation for drug development:

  • RANBP10 antibodies are essential tools for validating this protein as a therapeutic target in GBM

  • Immunohistochemistry analysis reveals high RANBP10 expression correlates with poor survival in GBM patients

  • This validation supports developing drugs targeting RANBP10 or its downstream pathways

  • Antibodies enable screening for compounds that modulate RANBP10 expression or function

• Companion diagnostic development:

  • RANBP10 antibodies can be utilized to develop immunohistochemical assays for patient stratification

  • Potential for identifying patients most likely to respond to therapies targeting the RANBP10-FBXW7-c-Myc axis

  • Standardized antibody-based assays could enable:

    • Tumor classification based on RANBP10 expression levels

    • Monitoring treatment response through sequential biopsies

    • Predicting potential resistance mechanisms

• Antibody-drug conjugate (ADC) research:

  • Investigating RANBP10 antibodies as potential targeting moieties for ADCs

  • While primarily cytoplasmic, RANBP10's expression in cancer cells makes it a candidate for internalization-dependent ADC approaches

  • Research focuses on:

    • Identifying internalizing epitopes through antibody screening

    • Optimizing antibody-toxin conjugation chemistry

    • Testing efficacy in preclinical GBM models

• Imaging and theranostic applications:

  • Developing radiolabeled or fluorescently tagged RANBP10 antibodies for:

    • Non-invasive imaging of tumors expressing high RANBP10 levels

    • Intraoperative visualization to guide surgical resection

    • Combined diagnostic and therapeutic (theranostic) approaches

• Targeting functional domains:

  • Developing domain-specific antibodies that disrupt RANBP10's interaction with the FBXW7 promoter

  • Creating antibodies that specifically block RANBP10's GEF activity while preserving other functions

  • These domain-specific tools enable more precise inhibition strategies and help identify critical functional regions for small molecule targeting

• Combination therapy optimization:

  • Using RANBP10 antibodies to monitor pathway modulation during combination treatments

  • Identifying synergistic drug combinations that enhance targeting of the RANBP10-FBXW7-c-Myc axis

  • Developing rational combination strategies based on mechanistic understanding of RANBP10 signaling networks

These emerging applications highlight the critical role of RANBP10 antibodies not only as research tools but also as enabling technologies for translational cancer research, potentially leading to novel therapeutic approaches for GBM and other cancers where RANBP10 plays a significant role.

How might RANBP10 research contribute to understanding therapeutic resistance in glioblastoma?

RANBP10 research offers several promising avenues for understanding and potentially overcoming therapeutic resistance in glioblastoma:

• c-Myc pathway modulation and resistance mechanisms:

  • RANBP10 regulates c-Myc stability through the FBXW7 pathway

  • c-Myc is a master regulator of cell growth and metabolism implicated in therapy resistance

  • Investigating how RANBP10 levels correlate with:

    • Response to standard GBM treatments (temozolomide, radiation)

    • Development of acquired resistance

    • Cancer stem cell maintenance and therapy evasion

  • This research could identify biomarkers of treatment resistance and potential combination therapy targets

• RANBP10 as a resistance biomarker:

  • Serial monitoring of RANBP10 expression during treatment could reveal:

    • Dynamic changes in expression associated with therapy response

    • Threshold levels that predict treatment failure

    • Clonal evolution patterns during therapy resistance

  • Methodological approach: Develop quantitative IHC or liquid biopsy techniques to measure RANBP10 in longitudinal patient samples

• Correlation with molecular resistance pathways:

  • Investigate associations between RANBP10 expression and established resistance mechanisms:

    • MGMT promoter methylation status

    • DNA damage repair pathway alterations

    • EGFR variant III expression

    • PD-L1 expression and immune evasion

  • These correlations may reveal novel resistance networks and rational targets for combination therapy

• RANBP10 in tumor microenvironment interactions:

  • Explore how RANBP10 modulates interactions between GBM cells and the tumor microenvironment

  • Potential roles in:

    • Regulating secretion of factors that recruit supporting stromal cells

    • Modifying extracellular matrix to facilitate invasion away from treatment areas

    • Influencing immune cell infiltration and function

  • Methodological approach: Single-cell analysis combining RANBP10 antibody staining with spatial transcriptomics

• Targeting RANBP10-dependent metabolic adaptations:

  • RANBP10-c-Myc axis likely influences metabolic reprogramming in GBM

  • c-Myc drives glycolysis and glutaminolysis that support rapid growth and therapy resistance

  • Research could identify:

    • Metabolic vulnerabilities in RANBP10-high tumors

    • Synergistic combinations of metabolic inhibitors with standard therapies

    • Biomarkers of metabolic adaptation in resistant tumors

• Therapeutic targeting strategies to overcome resistance:

  • Develop approaches to inhibit RANBP10 in combination with standard therapies

  • Options include:

    • Direct targeting through small molecules or peptides that disrupt RANBP10 function

    • Indirect targeting by enhancing FBXW7 activity or directly targeting c-Myc

    • Using CRISPR/Cas9 or antisense oligonucleotides to reduce RANBP10 expression

By investigating these aspects of RANBP10 biology in the context of therapeutic resistance, researchers may uncover novel mechanisms driving treatment failure in GBM and develop more effective treatment strategies for this devastating disease.