Rbt1 is a hypha-associated cell wall protein in Candida albicans involved in adhesion, biofilm formation, and virulence. It belongs to the Flo11 superfamily and contains domains critical for mediating interactions with abiotic surfaces (e.g., polystyrene) and cell aggregation .
Antibodies against Rbt1 are primarily used to study its localization, accessibility, and functional domains. Key methodologies include:
Epitope tagging: A V5 epitope was inserted into Rbt1 (between residues 273–274) to enable detection with anti-V5 antibodies .
Localization studies: Immunofluorescence revealed that Rbt1 is accessible to antibodies in hyphae but cryptic in yeast cells, suggesting morphological regulation of surface exposure .
Rbt1 is antibody-accessible in hyphae but masked in yeast due to differences in cell wall architecture .
Constitutive expression in yeast did not alter surface exposure, indicating structural regulation .
| Plasmid | Purpose | Key Features |
|---|---|---|
| pExp-V5 | Rbt1-V5 expression | V5 epitope insertion at residue 273 . |
| pBC542 | Heterologous Rbt1 expression | URA3 marker, RBT1 ORF . |
| Primer | Sequence (5’→3’) | Use Case |
|---|---|---|
| RBT1qFb | TCAATGCCGCATTTGTCGTGTCT | qPCR amplification . |
| V5R | CCAAACCCAACAATGGATTTGG | V5 epitope detection . |
Rbt1 enhances Candida adhesion to medical devices (e.g., catheters) through hydrophobic interactions .
Its aggregation domain promotes biofilm formation, a key virulence factor .
The term "RBT-1" is also used in unrelated contexts:
Renibus Therapeutics’ RBT-1: A preconditioning drug (stannic protoporfin/iron sucrose) for cardiothoracic surgery .
Human RBT1: A transcriptional co-activator studied in cancer biology .
No commercial Rbt1-specific antibodies are yet available; current studies rely on epitope tags.
Further work is needed to explore Rbt1 as a therapeutic target for Candida infections.
KEGG: cal:CAALFM_C403520CA
RBT1 is a novel transcriptional co-activator that interacts with Replication Protein A (RPA). Its significance in cancer research stems from its differential expression pattern between normal and cancer cells. RBT1 mRNA expression is significantly higher in cancer cell lines including MCF-7, ZR-75, SaOS-2, and H661, compared to normal non-immortalized human epithelial cells. This differential expression suggests RBT1 may play important roles in cellular transformation processes. Furthermore, yeast and mammalian one-hybrid analysis confirms that RBT1 functions as a strong transcriptional co-activator, with notably higher transcriptional activity in human cancer cells compared to normal primary non-immortalized epithelial cells .
RBT1 demonstrates primarily nuclear localization, which aligns with its function as a transcriptional co-activator. When visualized using green fluorescence protein (GFP) fusion techniques in transfected MDA-231 cells, EGFP-RBT1 fusion protein localizes predominantly to the nucleus. This subcellular localization can be detected through fluorescence microscopy after cells are fixed in paraformaldehyde, processed with appropriate blocking agents, and stained. The nuclear localization pattern supports RBT1's role in transcriptional processes and its interaction with nuclear proteins such as RPA .
RBT1 antibodies serve several critical functions in research settings:
Protein detection and quantification: Through Western blot analysis, immunohistochemistry, and ELISA assays
Protein-protein interaction studies: Using co-immunoprecipitation to confirm RBT1 binding partners
Subcellular localization studies: Through immunofluorescence microscopy
Functional inhibition studies: Using neutralizing antibodies to block RBT1 activity
Chromatin immunoprecipitation (ChIP): To identify genomic regions where RBT1 functions as a co-activator
For immunoprecipitation studies specifically, anti-RBT1 rabbit polyclonal antibodies have been generated against purified GST-RBT1 protein and successfully employed to pull down RBT1 and its interaction partners .
To effectively study RBT1-RPA interactions, researchers should consider the following methodological approach:
GST pull-down assays: Express RBT1 as a GST-fusion protein and use it to pull down RPA from cell lysates.
Co-immunoprecipitation: For co-IP experiments, researchers should:
Prepare protein extracts (400 μg recommended) from cells of interest
Mix with 30 μl of Protein G-Sepharose beads
Add anti-RPA32 mouse monoclonal antibody, anti-RBT1 rabbit polyclonal antibody, or non-specific IgG (as control)
Incubate overnight at 4°C with gentle rotation
Pellet beads, wash 3-5 times with appropriate buffer
Elute bound proteins by boiling in SDS sample buffer
Analyze by SDS-PAGE (15% gels recommended)
Transfer to PVDF membrane and probe with appropriate antibodies
Reciprocal verification: Always perform reciprocal IP experiments (IP with anti-RBT1 and blot for RPA, then IP with anti-RPA and blot for RBT1) to confirm the interaction.
For effective visualization of RBT1 subcellular localization:
GFP fusion strategy:
Transfect cells (e.g., MDA-231) with expression plasmids coding for EGFP-RBT1 fusion
Use EGFP-only transfection as control
Apply transfection reagents like LipofectAMINE according to manufacturer protocols
Allow 48 hours for optimal expression
Wash cells with PBS and fix in 3% paraformaldehyde/PBS
Reduce non-specific binding with blocking solution (2% BSA, 2% normal goat serum, 0.2% gelatin in PBS)
Immunofluorescence with native RBT1:
Fix cells as above
Permeabilize with 0.1% Triton X-100
Block non-specific binding
Incubate with anti-RBT1 primary antibody
Apply fluorophore-conjugated secondary antibody
Counterstain nucleus with DAPI
Examine using confocal or fluorescence microscopy
Controls and validation:
Include isotype control antibodies
Perform peptide competition assays to confirm specificity
Compare localization patterns with published data
To accurately quantify RBT1 expression differences:
mRNA quantification via RT-PCR:
Protein quantification:
Prepare total cell lysates using appropriate lysis buffers
Separate proteins via SDS-PAGE
Transfer to membranes for Western blotting
Probe with anti-RBT1 antibodies
Use appropriate loading controls (e.g., GAPDH, β-actin)
Perform densitometric analysis for quantification
Statistical analysis:
Run experiments with at least three biological replicates
Apply appropriate statistical tests (t-test for two groups, ANOVA for multiple groups)
Consider non-parametric alternatives when data doesn't follow normal distribution
Evaluating antibody specificity is critical for reliable RBT1 research. Recommended approaches include:
Knockout/knockdown validation:
Generate RBT1 knockdown cells using siRNA or shRNA
Create RBT1 knockout cells using CRISPR/Cas9
Compare antibody signal between wildtype and knockout/knockdown samples
Absence of signal in knockout/knockdown samples confirms specificity
Peptide competition assays:
Pre-incubate anti-RBT1 antibody with excess purified RBT1 protein or immunizing peptide
Run parallel Western blots or immunostaining with blocked and unblocked antibody
Signal reduction/elimination in blocked samples indicates specificity
Multiple antibody comparison:
Use antibodies from different vendors or raised against different epitopes
Compare staining/blotting patterns
Consistent patterns across antibodies suggest higher reliability
Mass spectrometry validation:
Immunoprecipitate RBT1 using the antibody
Analyze precipitated proteins by mass spectrometry
Confirmation of RBT1 peptides validates antibody specificity
For investigating RBT1's co-activation function:
Reporter gene assays:
Construct GAL4-RBT1 fusion proteins for mammalian one-hybrid analysis
Transfect cells with GAL4-RBT1 expression vector plus GAL4-responsive reporter
Compare transcriptional activity between cancer and normal cell lines
Include appropriate controls (GAL4-DNA binding domain alone, known activator fusions)
Normalize reporter activity to account for transfection efficiency
Dose-response relationships:
Transfect increasing amounts of RBT1 expression vector
Monitor changes in reporter gene activity
Plot dose-response curves to characterize activation potency
Domain mapping:
Generate truncated or mutated versions of RBT1
Test each construct in reporter assays
Identify domains critical for co-activation function
Protein-protein interaction mapping:
Perform IP-mass spectrometry to identify RBT1 interactors beyond RPA
Confirm interactions through reciprocal co-IPs
Map interaction domains through deletion construct analysis
To properly investigate differential RBT1 activity:
Cell line selection:
Multi-level analysis approach:
Measure mRNA levels via RT-qPCR
Quantify protein expression via Western blot
Assess functional activity through reporter assays
Analyze downstream gene expression changes via RNA-seq
Mechanistic investigations:
Examine post-translational modifications specific to cancer cells
Assess differences in protein-protein interactions
Investigate differential chromatin binding patterns
Analyze alterations in subcellular localization
Functional consequences:
Perform RBT1 knockdown in both cell types
Compare effects on proliferation, migration, and survival
Assess impact on gene expression profiles
Evaluate changes in response to cellular stressors
Researchers frequently encounter these challenges when working with RBT1 antibodies:
High background signal:
Cross-reactivity issues:
Solution: Validate antibody specificity using knockout/knockdown controls
Pre-absorb antibody with potential cross-reacting proteins
Use monoclonal antibodies if polyclonal antibodies show cross-reactivity
Optimize Western blot conditions to minimize non-specific bands
Inconsistent immunoprecipitation results:
Solution: Optimize lysis buffer composition to preserve protein interactions
Adjust antibody-to-lysate ratio
Consider crosslinking approaches to stabilize transient interactions
Use gentle washing conditions to preserve weak interactions
Epitope masking during fixation:
Solution: Test multiple fixation methods (paraformaldehyde, methanol, acetone)
Try different epitope retrieval techniques
Use antibodies targeting different epitopes
Consider native-condition immunofluorescence
When facing contradictory results:
Systematic variance analysis:
Compare experimental conditions in detail (cell types, culture conditions, assay methods)
Identify potential variables that might explain discrepancies
Replicate published protocols exactly before introducing modifications
Cell type-specific effects:
Consider that RBT1 function may genuinely differ between cell types
Compare results across normal and transformed cells systematically
Examine expression levels of key RBT1 interaction partners in each system
Technical vs. biological variation:
Distinguish between technical artifacts and true biological differences
Increase biological and technical replicates
Apply appropriate statistical methods to assess significance of differences
Integrated data approach:
Combine multiple methodologies to build a consensus view
Use orthogonal techniques to validate key findings
Consider system-specific factors that might influence RBT1 function
For robust statistical analysis of RBT1 expression data:
Parametric vs. non-parametric methods:
Test data normality with Shapiro-Wilk or Kolmogorov-Smirnov tests
Use parametric tests (t-test, ANOVA) for normally distributed data
Apply non-parametric alternatives (Mann-Whitney, Kruskal-Wallis) for non-normal distributions
Multiple testing correction:
Effect size quantification:
Calculate appropriate effect size measures (Cohen's d, fold change)
Report confidence intervals alongside p-values
Consider biological significance beyond statistical significance
Advanced modeling approaches:
Emerging technologies promise to enhance RBT1 antibody quality and applications:
AI-driven antibody design:
Single B-cell antibody discovery:
This technology enables isolation of highly specific monoclonal antibodies
Could yield RBT1 antibodies with superior specificity and sensitivity
Potential to develop antibodies against conformational epitopes
Fragment-based antibody engineering:
Multiparametric antibody development:
Design antibody panels that target different RBT1 epitopes
Enable simultaneous detection of RBT1 modifications and interaction states
Support more comprehensive analysis of RBT1 biology
To elucidate RBT1's precise role in transcription:
ChIP-sequencing studies:
Map genome-wide binding sites of RBT1 using ChIP-seq
Compare binding profiles between normal and cancer cells
Identify DNA motifs associated with RBT1 recruitment
Proximity-dependent labeling:
Employ BioID or APEX2 fusions with RBT1
Identify proteins in close proximity to RBT1 at chromatin
Map the dynamic RBT1 interactome during transcriptional activation
CUT&RUN and CUT&Tag approaches:
Apply these techniques for higher resolution mapping of RBT1 binding
Reduce background compared to traditional ChIP methods
Enable analysis in samples with limited material
Cryo-EM structural studies:
Determine structural basis of RBT1-RPA interaction
Visualize RBT1 within transcriptional complexes
Guide structure-based development of functional modulators
For meaningful integration with cancer biology:
Cancer dependency screening:
Assess cancer cell dependency on RBT1 using CRISPR screens
Identify synthetic lethal interactions with RBT1 depletion
Determine cancer types most dependent on RBT1 function
Patient sample analysis:
Examine RBT1 expression in tumor tissue microarrays
Correlate expression with clinical outcomes
Assess potential as prognostic or predictive biomarker
Functional genomics integration:
Combine RBT1 studies with multi-omics approaches
Identify RBT1-regulated gene networks
Map RBT1 function to cancer hallmark pathways
Therapeutic exploration:
Assess RBT1 as potential therapeutic target
Develop strategies to modulate RBT1 activity
Evaluate combination approaches targeting RBT1-dependent pathways