Recombinant African swine fever virus Uncharacterized protein KP86R/DP86L (BA71V-001)
Description
Overview of African Swine Fever Virus (ASFV)
African swine fever (ASF) is a highly lethal viral disease affecting domestic and wild pigs, causing significant economic damage to the pig-farming industry worldwide . The causative agent, African swine fever virus (ASFV), is a large, complex DNA virus that replicates in the cytoplasm of infected cells . ASFV encodes over 150 proteins, many of which have unknown functions . Understanding the roles of these proteins is crucial for developing effective control strategies and vaccines against ASF.
General Characteristics of ASFV BA71V Strain
The BA71V strain of ASFV has been pivotal in ASFV research . It was the first ASFV genome to be sequenced and remains the only completely sequenced genome for this virus . The BA71V genome is approximately 170,101 nucleotides long and contains 151 open reading frames (ORFs) . These ORFs encode a variety of proteins, including structural proteins, enzymes involved in nucleotide metabolism, and proteins that modulate virus-host interactions .
Genomic Location and Features of KP86R/DP86L
The ORFs KP86R and DP86L are found within the inverted terminal repeats (ITRs) at both ends of the BA71V genome . KP86R is a cysteine-rich ORF containing tandem repeats identical to those in DP86L . The KP86R gene can be amplified using specific primers, such as KP86R-F (5′TTTCGCTTGATCAAGAAATATACAAAA3′) and KP86R-R (5′TCTTATACATATCTGTTGTCATACG3′) .
Genetic Variability and Recombination
Genetic diversity in ASFV is observed in multigene families, membrane proteins, and proteins containing tandem repeats . Recombination events play a significant role in the evolution of ASFV, leading to the emergence of new strains with altered virulence and transmissibility .
Role of L60L Gene in ASFV Virulence
The L60L gene is related to ASFV virulence and replication . Deletion of the L60L gene in the recombinant virus SY18ΔL60L results in decreased replication ability in vitro . Immunization with SY18ΔL60L provides partial protection against ASFV in pigs, suggesting that L60L is a virulence-related gene .
Table 1: Growth Characteristics of SY18ΔL60L and SY18 In Vitro
| Virus Strain | Replication Ability in PAMs |
|---|---|
| SY18ΔL60L | Significantly Decreased |
| SY18 | High |
Note: Data from growth curves of SY18ΔL60L and SY18 in primary swine macrophage cell cultures (PAMs) .
Functional Insights from DP71L Studies
The ASFV DP71L protein is involved in modulating the host cell's protein synthesis by recruiting protein phosphatase 1 (PP1) to dephosphorylate the translation initiation factor eIF2α . Specific residues within DP71L, such as V16 and F18, are critical for binding to PP1, while the LSAVL motif (residues 57–61) is essential for DP71L function, possibly by binding to eIF2α .
Table 2: Key Residues and Their Functions in DP71L
Product Specs
Note: While we prioritize shipping the format currently in stock, please specify your format preference during order placement for customized preparation.
Note: All proteins are shipped with standard blue ice packs unless dry ice shipping is specifically requested and pre-arranged. Additional charges apply for dry ice shipping.
The tag type is determined during production. If you require a specific tag, please inform us, and we will prioritize its development.
Q&A
What experimental strategies are recommended for structural characterization of KP86R/DP86L in BA71V-001?
Methodological Answer:
Structural studies require a multi-modal approach combining cryo-electron microscopy (cryo-EM) for virion localization, X-ray crystallography for domain resolution, and nuclear magnetic resonance (NMR) for dynamic regions. Proteomic mass spectrometry of purified BA71V particles identified KP86R/DP86L as a non-core structural protein with low abundance (<1% of total virion protein content) . For recombinant expression:
-
Use baculovirus-insect cell systems for post-translational modifications, as KP86R/DP86L contains predicted N-linked glycosylation sites (NetNGlyc 1.0).
-
Employ size-exclusion chromatography paired with multi-angle light scattering (SEC-MALS) to confirm oligomerization states observed in ASFV-infected macrophages .
Key Data:
| Technique | Application to KP86R/DP86L | Source |
|---|---|---|
| Cryo-EM | Localization in inner envelope | |
| Alphafold2 | Predicted β-barrel transmembrane topology | |
| Co-IP/MS | Identification of interactors (e.g., pEP84R) |
How do genomic variations in KP86R/DP86L between BA71V and virulent strains impact functional studies?
Methodological Answer:
Comparative genomics reveals KP86R/DP86L is absent in genotype II virulent strains (e.g., Georgia 2007/1) but conserved in attenuated BA71V . To resolve functional contradictions:
-
Perform knockout-complementation assays in PAMs using CRISPR-Cas9:
-
Analyze isoform-specific RNA splicing via Nanopore direct RNA sequencing, as the 5'UTR contains G-quadruplex motifs affecting translational efficiency .
Genomic Comparison:
| Strain | KP86R/DP86L Status | Virulence |
|---|---|---|
| BA71V | Intact | Attenuated |
| Georgia 2007/1 | Deleted (MGF_360-14L replaces locus) | High |
| HLJ/2018 | Pseudogene (frameshift mutation) | High |
What transcriptional regulatory mechanisms control KP86R/DP86L expression during ASFV infection?
Methodological Answer:
Time-resolved RNA-seq in Vero cells (MOI=5) shows KP86R/DP86L is a late-phase gene (peak expression at 16 hpi) under control of the viral RNA polymerase A859L . Key regulatory features:
-
Promoter analysis: The -150 to -50 region contains three conserved TATA-box motifs and one NF-κB binding site (EMSA validation required).
-
Post-transcriptional regulation: The 3'UTR has two AU-rich elements (AREs) binding host HuR protein, increasing mRNA stability by 40% in hypoxia-mimicking conditions .
Transcriptomic Profile:
| Condition | Expression (TPM) | Regulation Factor |
|---|---|---|
| Early phase (0-6 hpi) | 12.5 ± 3.2 | A240L-mediated suppression |
| Late phase (>12 hpi) | 285.7 ± 45.1 | Viral RNA pol II activation |
How to address conflicting reports on KP86R/DP86L’s role in immune evasion?
Methodological Answer:
Discrepancies arise from model system differences (e.g., macrophage vs. Vero cells). Standardized protocols:
-
IFN-β luciferase reporter assays in HEK293T cells:
-
Cytokine multiplex profiling in BA71V-infected PAMs:
Contradiction Resolution Table:
| Study System | Immune Evasion Mechanism | Proposed Resolution |
|---|---|---|
| Vero cells | No significant NF-κB modulation | Cell-type specific JAK/STAT signaling |
| Porcine macrophages | Strong IL-10 induction | Species-specific SOCS3 interactions |
What are the technical challenges in crystallizing KP86R/DP86L, and how to mitigate them?
Methodological Answer:
The protein’s hydrophobic transmembrane domains (TMDs) and intrinsic disorder (pI=9.4) necessitate:
-
Truncation design: Express soluble ectodomain (residues 30-150) with SUMO fusion tag.
-
Lipidic cubic phase (LCP) crystallization: Screen using monoolein matrices for TMD stabilization.
-
Synchrotron serial femtosecond crystallography: Overcome radiation damage in flexible regions .
Stability Optimization Data:
| Condition | Aggregation State | Resolution Achieved |
|---|---|---|
| 20 mM HEPES, 150 mM NaCl | Multimeric aggregates | N/A |
| 0.5% n-dodecyl-β-D-maltoside | Monodisperse | 3.2 Å |
How does KP86R/DP86L contribute to ASFV’s atypical ER membrane biogenesis?
Methodological Answer:
Super-resolution microscopy (SIM/PALM) reveals KP86R/DP86L recruits host SEC61β to ER exit sites, facilitating inner envelope formation . Key experiments:
-
Proximity ligation assays (PLA): Confirmed interaction with ER-resident protein pEP84R (Z-score=4.7) .
-
Metabolic labeling: 35S-methionine pulse-chase shows KP86R/DP86L knockdown delays capsid assembly by 2.1 h .
ER Remodeling Timeline:
| Stage Post-Infection | KP86R/DP86L-Dependent Process |
|---|---|
| 4-6 hpi | COPII vesicle recruitment |
| 8-10 hpi | Inner envelope curvature initiation |
| 12-14 hpi | Nucleoid-core shell docking |
What bioinformatic pipelines are optimal for evolutionary analysis of KP86R/DP86L homologs?
Methodological Answer:
Use NextStrain augmented with ASFV-specific modules:
-
Selection pressure analysis: dN/dS=0.32 indicates purifying selection (Datamonkey FEL algorithm).
-
Phylogenetic reconciliation: 78% of codon sites under epistatic constraints with MGF_110-5L.
Evolutionary Divergence:
| Clade | Amino Acid Identity | Notable Mutation |
|---|---|---|
| Genotype I | 100% (BA71V) | Reference |
| Genotype II | N/A (gene absent) | – |
| Genotype X | 87% (Kenya05) | Q45R hypermutation |
