Recombinant Apis mellifera ligustica Cytochrome c oxidase subunit 3 (COIII)
Description
Gene Structure and Organization
The Cytochrome c oxidase subunit 3 (COIII) gene in Apis mellifera ligustica is encoded in the mitochondrial genome. The complete COIII gene sequence spans 780 base pairs, exhibiting significant nucleotide diversity with 18 synonymous (functionally silent) and 5 non-synonymous (amino acid-changing) single nucleotide polymorphisms (SNPs) . This genetic variation makes COIII a valuable marker for population genetics and evolutionary studies of honeybee subspecies.
The mitochondrial genome organization in honeybees shows interesting evolutionary patterns, particularly when compared with other insects such as Drosophila. While several tRNA gene shifts have been documented between Apis and Drosophila mitochondrial genomes, shifts involving protein-coding genes like COIII have not yet been conclusively demonstrated . This conservation of gene order for protein-coding genes suggests functional constraints maintaining the genomic arrangement of these crucial respiratory proteins.
Molecular Evolution
The COIII sequence exhibits notable nucleotide composition patterns characteristic of honeybee mitochondrial DNA. Similar to other mitochondrial genes in Apis mellifera, the COIII gene shows a pronounced A+T richness compared to its Drosophila counterpart . This nucleotide bias has important implications for primer design, PCR amplification conditions, and sequence analysis in research applications.
Role in Cellular Respiration
As a subunit of cytochrome c oxidase (Complex IV), COIII plays a crucial role in the electron transport chain within mitochondria. This enzyme catalyzes the final step of cellular respiration, where electrons are transferred to oxygen, which is subsequently reduced to water. The enzymatic reaction is essential for energy production through oxidative phosphorylation, making COIII vital for cellular metabolism and energy homeostasis in honeybees.
Evolutionary Conservation
Mitochondrial genes like COIII are valuable for evolutionary studies due to their maternal inheritance, relatively high mutation rates, and absence of recombination. Comparative analyses of COIII sequences among different honeybee subspecies reveal significant insights into evolutionary relationships within Apis mellifera and related species.
Parsimony analyses using mouse and Xenopus sequences as outgroups have shown significantly more amino acid substitutions on the branch leading to Apis (120) than on the branch leading to Drosophila (44), indicating different long-term evolutionary rates between hymenopteran and dipteran mitochondrial DNA . This evolutionary pattern provides valuable context for understanding the selective pressures and constraints acting on COIII in honeybees.
Taxonomic and Phylogenetic Studies
The COIII gene sequence has proven invaluable for taxonomic classification and phylogenetic analysis of honeybee subspecies. Research utilizing COIII sequence data has contributed significantly to understanding the genetic diversity and evolutionary relationships within Apis mellifera populations across different geographical regions.
In particular, studies examining variations in the COIII gene have helped characterize endemic honeybee populations in regions such as Saudi Arabia, providing insights into the genetic structure of Apis mellifera jemenitica, a subspecies that occurs naturally in both Africa and Asia . Such research is crucial for conservation efforts and sustainable apiculture management.
Genetic Diversity Assessment
COIII sequence analysis has been instrumental in assessing genetic variation among honeybee populations. Research focusing on Apis mellifera jemenitica has utilized COIII sequence data to identify distinct haplogroups, enhancing our understanding of population structures and genetic diversity patterns .
Compared to other mitochondrial genes like COII, COIII gene sequences have shown specific characteristics that make them useful for certain genetic analyses. While COII sequences might be more informative for some applications based on restriction profiles and amino acid changes, COIII sequences have revealed high similarity to African subspecies in some studies, providing complementary information for comprehensive genetic analyses .
Expression and Purification
Recombinant Apis mellifera ligustica COIII protein can be produced through various expression systems, though the search results do not specify the particular system used for commercial production. The recombinant protein is typically supplied with a tag, though the specific tag type may vary and is determined during the production process .
Commercial preparations of recombinant COIII are typically supplied in a stabilizing buffer consisting of Tris-based buffer with 50% glycerol, optimized specifically for this protein . This formulation ensures stability and activity during shipping and storage.
Research Applications
Recombinant COIII is commercially available for research applications, typically supplied in 50 μg quantities, with other quantities available upon request . The protein is primarily used in enzyme-linked immunosorbent assays (ELISA) and other immunological techniques for detecting and measuring COIII-specific antibodies or for generating antibodies against this protein.
The availability of recombinant COIII facilitates research in various fields, including:
-
Evolutionary biology and phylogenetic studies
-
Apiculture research and honeybee health monitoring
-
Mitochondrial function and cellular respiration studies
-
Development of diagnostic tools for honeybee population characterization
Product Specs
Please note: We prioritize shipping the format currently in stock. However, if you have a specific format requirement, kindly specify it in your order notes. We will then prepare the product accordingly.
Note: Our proteins are shipped with standard blue ice packs by default. If you require dry ice shipping, please inform us in advance as additional fees will apply.
Generally, the shelf life of liquid form is 6 months at -20°C/-80°C. The shelf life of lyophilized form is 12 months at -20°C/-80°C.
Target Background
Q&A
What is the functional role of COIII in Apis mellifera ligustica mitochondrial respiration, and how does it differ from other COX subunits?
COIII (cytochrome c oxidase subunit III) is a component of the mitochondrial cytochrome c oxidase (COX) complex, which catalyzes the final step of the electron transport chain. Unlike subunits COI and COII, which are encoded by mitochondrial DNA and directly involved in oxygen reduction, COIII is nuclear-encoded and primarily stabilizes the complex structure . In Apis mellifera, COIII interacts with other subunits to maintain heme groups and electron transfer efficiency, though its exact catalytic role remains less defined compared to COI/COII .
How should researchers design PCR primers for amplifying COIII from A. mellifera ligustica?
Key considerations:
-
Primer specificity: Use conserved regions flanking COIII to avoid cross-reactivity with other mitochondrial genes (e.g., COI, COII) .
-
Annealing optimization: Adjust temperatures based on primer GC content. For example, Francisco et al. modified annealing temperatures to 42–43°C for certain mtDNA regions .
-
Fragment length: Target a 500–700 bp region for sequencing accuracy and phylogenetic analysis .
Example primer design strategy:
| Target Region | Forward Primer (5’ → 3’) | Reverse Primer (5’ → 3’) | Annealing Temp (°C) |
|---|---|---|---|
| COIII | GGTCAACAAATCATAAAGATATTGG | TAAACTTCAGGGTGACCAAAAAATCA | 50–55 |
What challenges arise when integrating COIII data with nuclear (e.g., 18S rRNA) or other mitochondrial markers (e.g., COI) for phylogenetic studies?
Key challenges and solutions:
-
Different evolutionary rates: Mitochondrial COIII evolves faster than nuclear 18S rRNA, requiring weighted analysis to resolve deep vs. shallow divergences .
-
Gene incongruence: Mitochondrial COIII may show different branching patterns than nuclear genes due to introgression or lineage sorting. Combine COIII with 18S rRNA to improve bootstrap support .
-
Recombination artifacts: Use coalescent-based methods (e.g., BEAST) to account for ancestral polymorphism in mitochondrial genes .
Example workflow:
-
Sequence COIII and COI from A. mellifera subspecies.
-
Align with outgroups (e.g., Drosophila) to infer gene order shifts .
-
Apply concatenated phylogenies (COIII + 18S rRNA) to resolve ambiguous nodes .
How do genetic variations in COIII impact its utility in taxonomic and population studies?
Key insights:
-
Variable sites: COIII exhibits higher sequence divergence (up to 32.4% in Babesia) compared to COB or 18S rRNA, enabling finer resolution of intraspecies lineages .
-
Phylogenetic resolution: In Apis mellifera, COIII sequence data can distinguish subspecies (e.g., A. m. ligustica vs. A. m. carnica) when combined with COI .
-
Limitations: High A+T richness in Apis mtDNA (e.g., COI/COII) may lead to homoplasy; pair with nuclear markers to mitigate .
Case study: Turkish A. mellifera subspecies showed COI sequence diversity, but COIII data would enhance resolution of recent population splits .
What methodological pitfalls should researchers avoid when expressing recombinant COIII in heterologous systems?
Critical considerations:
-
Protein folding: COIII requires proper mitochondrial import and chaperone interactions. Use E. coli with mitochondrial-targeting peptides or eukaryotic systems (e.g., yeast) .
-
Heme incorporation: Ensure correct heme binding via co-expression with cytochrome c oxidase core subunits (e.g., COI/COII) .
-
Protease sensitivity: In Rhodobacter, COIII stabilizes the core complex against proteolysis. Monitor degradation under aerobic conditions .
Troubleshooting table:
| Issue | Cause | Solution |
|---|---|---|
| Low recombinant COIII yield | Misfolding or aggregation | Add solubility tags (e.g., GST) |
| Incomplete heme binding | Absent core subunits | Co-express with COI/COII |
| Instability in aerobic conditions | Proteolytic cleavage | Include protease inhibitors |
How does COIII sequence data inform mitochondrial genome assembly and annotation in A. mellifera ligustica?
Applications:
-
Gene order validation: Compare COIII positions with ancestral insect mitochondrial genomes to detect rearrangements .
-
tRNA annotation: COIII flanks tRNA genes (e.g., tRNA(Lys), tRNA(Trp) in Apis). Use COIII as a scaffold to resolve tRNA placements .
-
Phylogenomic studies: Integrate COIII with COI/COII to reconstruct Apis phylogeny and test for gene flow between subspecies .
Example workflow:
-
Align COIII sequences with Apis and Drosophila mtDNA.
-
Identify conserved synteny blocks (e.g., COIII-ND3-ND5 in Meliponini) .
What advanced bioinformatics tools are recommended for analyzing COIII sequence data in evolutionary studies?
Tool recommendations:
-
Phylogenetic inference: RAxML or BEAST for Bayesian or maximum likelihood analysis, incorporating rate heterogeneity models .
-
Gene order analysis: Mauve or MUMmer to detect rearrangements between Apis and Drosophila .
-
Haplotype networks: PopART to visualize intraspecies COIII diversity in A. mellifera .
Example output:
| Tool | Application | Example Analysis |
|---|---|---|
| RAxML | ML phylogeny of COIII sequences | Resolving Apis subspecies clusters |
| Mauve | Mitochondrial genome rearrangement | Comparing Apis vs. Drosophila |
How can researchers address conflicting phylogenetic signals between COIII and other mitochondrial markers (e.g., COI)?
Strategies:
-
Data partitioning: Treat COIII and COI as separate partitions in phylogenetic models to account for differing evolutionary pressures .
-
Species tree vs. gene tree: Use ASTRAL or Buckley methods to reconcile discordant trees due to incomplete lineage sorting .
-
Functional validation: Correlate COIII sequence variants with respiratory performance (e.g., oxygen consumption assays) .
Case study: In Babesia, combining COIII with 18S rRNA improved bootstrap support for clades unresolved by COB alone .
What are the implications of COIII sequence diversity for haplotype-specific functional studies in A. mellifera ligustica?
Key implications:
-
Thermal adaptation: COIII variants may influence mitochondrial efficiency under varying temperatures. Test using polarized Apis subspecies .
-
Disease resistance: Link COIII haplotypes to parasitic resistance (e.g., Varroa mite interactions) via GWAS .
-
Honey production: Correlate COIII diversity with metabolic traits (e.g., nectar processing efficiency) .
Research gap: Few studies have linked COIII polymorphisms to phenotypes in Apis. Prioritize functional genomics approaches.
How can researchers optimize COIII gene expression in honey bee cell lines for functional studies?
Key optimizations:
-
Cell model selection: Use hemocyte-derived cell lines (e.g., A. mellifera cells in Grace’s medium) for mitochondrial activity .
-
Promoter choice: Test Bombyx actin or Drosophila heat shock promoters for high expression .
-
RNAi validation: Use dsRNA targeting COIII to confirm gene-specific effects (e.g., reduced mitochondrial membrane potential) .
Example protocol:
