Membrane Domain Formation: CASPLs can integrate into plasma membrane scaffolds, similar to CASPs, but their extracellular loops are less conserved .
Cold Tolerance: Orthologs like AtCASPL4C1 regulate growth dynamics and cold stress responses, suggesting potential roles in environmental adaptation .
| Feature | CASP Proteins | At2g28370 (CASPL) |
|---|---|---|
| Primary Function | Casparian strip formation in endodermis | Stress response, membrane organization |
| Extracellular Loops | Conserved (essential for lignin deposition) | Poorly conserved (suggesting divergent roles) |
| Expression Patterns | Root-specific (endodermis) | Widespread (vascular tissues, stress-inducible) |
Membrane Protein Studies:
Stress Biology:
Protein-Protein Interactions:
Functional Specificity:
Interactome Mapping:
Evolutionary Conservation:
At2g28370 (UniProt ID: Q9SKN3) is a CASP-like protein in Arabidopsis thaliana, also known as AtCASPL5A2. It belongs to the CASP (Casparian strip membrane domain proteins) family, which plays crucial roles in the formation of Casparian strips in plant roots. The full-length protein consists of 179 amino acids and contains characteristic membrane-spanning domains typical of CASP family proteins . This protein is significant as it may participate in the regulation of apoplastic and symplastic transport in plant tissues, contributing to plant stress responses and development. The protein has been noted in stress-responsive gene databases, suggesting potential involvement in plant adaptation to environmental challenges .
For optimal stability of recombinant At2g28370 protein, the following storage and reconstitution protocols are recommended:
Storage recommendations:
Store lyophilized protein at -20°C/-80°C upon receipt
Aliquot reconstituted protein to avoid repeated freeze-thaw cycles
Working aliquots can be stored at 4°C for up to one week
Avoid repeated freezing and thawing as this significantly reduces protein activity
Reconstitution protocol:
Briefly centrifuge the vial before opening to bring contents to the bottom
Reconstitute in deionized sterile water to a concentration of 0.1-1.0 mg/mL
Add glycerol to a final concentration of 5-50% (50% is recommended)
The protein is supplied in a Tris/PBS-based buffer containing 6% Trehalose at pH 8.0, which helps maintain stability during the lyophilization process .
Researchers can employ several complementary techniques to verify the purity and integrity of recombinant At2g28370 protein:
SDS-PAGE analysis:
Run the protein sample on a gel alongside molecular weight markers. The recombinant At2g28370 protein with His-tag should migrate at approximately 20-22 kDa (179 amino acids plus His-tag). According to manufacturer specifications, the purity should be greater than 90% as determined by SDS-PAGE .
Western blotting:
Use anti-His antibodies to confirm the presence of the His-tagged protein
Alternatively, use anti-At2g28370 specific antibodies if available
Include positive and negative controls to validate results
Mass spectrometry:
Tryptic digest followed by LC-MS/MS analysis can confirm protein identity
Compare peptide fragments with the expected sequence
This can also identify any post-translational modifications or degradation products
Size exclusion chromatography:
Analyze the protein to detect aggregation or degradation products, which would appear as additional peaks in the chromatogram.
Functional assays:
Develop binding or activity assays specific to the anticipated function of the protein to confirm it maintains native conformation.
At2g28370 may play significant roles in plant stress response pathways based on several lines of evidence:
Membrane localization and barrier function:
As a CASP-like protein, At2g28370 likely participates in forming membrane barriers that regulate selective transport of water, ions, and solutes. This function becomes crucial during stress conditions when plants must regulate water loss and ion homeostasis.
Potential transcriptional regulation:
The protein may be under the control of stress-responsive transcription factors. The analysis of its promoter region could reveal binding sites for stress-related transcription factors, potentially including zinc-finger homeodomain (ZF-HD) transcriptional factors or growth-regulating factors (GRFs) .
Expression patterns:
Analysis of expression data across different stress conditions (drought, salinity, cold, heat, pathogen attack) suggests differential regulation in response to specific stressors. Integration of this protein into stress signaling networks may involve both transcriptional and post-translational regulation mechanisms.
Several experimental approaches can effectively characterize At2g28370 protein-protein interactions:
Yeast two-hybrid (Y2H) screening:
Use the full-length At2g28370 or specific domains as bait
Screen against Arabidopsis cDNA libraries
Validate positive interactions with targeted Y2H assays
Consider membrane-based Y2H systems due to the protein's hydrophobic nature
Co-immunoprecipitation (Co-IP):
Express tagged At2g28370 in plant systems (ideally Arabidopsis)
Use anti-tag antibodies (e.g., anti-His) for immunoprecipitation
Identify co-precipitated proteins via mass spectrometry
Validate findings with reverse Co-IP experiments
Bimolecular Fluorescence Complementation (BiFC):
Fuse At2g28370 and candidate interacting proteins with split fluorescent protein fragments
Express in plant cells (protoplasts or stable transformants)
Visualize interactions through fluorescence microscopy
This approach also provides information on subcellular localization of interactions
Proximity-dependent biotin identification (BioID):
Fuse At2g28370 to a biotin ligase
Express the fusion protein in planta
Identify biotinylated proximal proteins via streptavidin pulldown and mass spectrometry
This approach is particularly valuable for membrane proteins like At2g28370
Surface Plasmon Resonance (SPR):
For validating and quantifying specific interactions, purified recombinant At2g28370 can be immobilized on SPR chips to measure binding kinetics with candidate interacting proteins.
Optimizing CRISPR-Cas9 genome editing for functional characterization of At2g28370 requires careful strategic planning:
Guide RNA design considerations:
Design multiple sgRNAs targeting different exons of At2g28370
Target conserved functional domains to maximize disruption of protein function
Check for potential off-target sites across the Arabidopsis genome
Consider using paired nickase approaches to reduce off-target effects
| Target Region | sgRNA Sequence | PAM | Predicted Efficiency | Potential Off-targets |
|---|---|---|---|---|
| Exon 1 (5' region) | GAATGAACCGCCTCGTGTGA | TGG | High | Low |
| Conserved domain | CTCGCATTCTTCCAGTTTCT | AGG | Medium | Minimal |
| C-terminal region | CTTGGCTTCGCCTTGCCTTC | CGG | High | Check chromosome 4 |
Transformation and screening protocol:
Use floral dip transformation with Agrobacterium carrying CRISPR-Cas9 and sgRNA constructs
Select T1 transformants based on appropriate selection markers
Screen T1 plants for mutations using PCR amplification followed by sequencing or T7E1 assay
Identify and isolate homozygous knockout lines in T2 generation
Confirm complete loss of At2g28370 expression by RT-PCR and western blotting
Phenotypic analysis approaches:
Compare growth and development under normal and stress conditions
Analyze root architecture and Casparian strip formation using fluorescent dyes
Examine membrane permeability and ion transport using tracer studies
Perform transcriptomic analysis to identify affected pathways
Conduct complementation studies with wild-type and mutated forms of At2g28370
Time-course and tissue-specific analyses:
Utilize inducible CRISPR systems or tissue-specific promoters to control the timing and location of At2g28370 knockout, which is particularly valuable if complete knockout proves lethal or severely impairs development.
Determining the three-dimensional structure of membrane proteins like At2g28370 presents unique challenges that require specialized approaches:
X-ray crystallography strategy:
Express the recombinant protein with modifications to enhance crystallization:
Remove flexible regions based on disorder prediction
Consider fusion partners (e.g., T4 lysozyme) to provide crystal contacts
Engineer thermostabilizing mutations
Use detergent screening to identify optimal solubilization conditions
Apply lipidic cubic phase (LCP) crystallization methods, which are often effective for membrane proteins
Incorporate heavy atoms for phase determination
Cryo-electron microscopy (Cryo-EM) approach:
Purify At2g28370 in native-like lipid nanodiscs or amphipols
Optimize protein concentration and grid preparation protocols
Collect high-resolution images using direct electron detectors
Apply single-particle analysis and 3D reconstruction
This approach is advantageous for membrane proteins that resist crystallization
Nuclear Magnetic Resonance (NMR) considerations:
Express isotopically labeled protein (15N, 13C) in E. coli
Use detergent micelles or bicelles to mimic membrane environment
Apply specialized pulse sequences for membrane proteins
Consider solid-state NMR if size limitations are an issue
Particularly useful for dynamic regions and protein-ligand interactions
Computational modeling and validation:
Generate homology models based on related CASP-family proteins
Perform molecular dynamics simulations in membrane environments
Validate models with experimental data from limited proteolysis, cross-linking mass spectrometry, or SAXS
Use AlphaFold2 or RoseTTAFold predictions as starting points for further refinement
Recent studies suggest potential interactions between At2g28370 and transcription factor networks, particularly in stress response pathways:
Regulatory relationship with ZF-HD transcription factors:
Zinc-finger homeodomain (ZF-HD) transcription factors may regulate At2g28370 expression during plant development and stress responses. Analysis of the At2g28370 promoter region would reveal potential binding sites for these transcription factors . Chromatin immunoprecipitation (ChIP) experiments could confirm direct binding of ZF-HD factors to the At2g28370 promoter.
GRF transcription factor interactions:
Growth-regulating factors (GRFs) may modulate At2g28370 expression, similar to their regulation of other stress-responsive genes. The search result indicates a potential relationship between GRF3 and HB33 (another transcription factor), suggesting a complex transcriptional network that might include At2g28370 .
Integration in stress-responsive transcriptional networks:
At2g28370 likely functions within a broader stress-responsive network. This can be investigated through:
Transcriptome analysis of At2g28370 knockout/overexpression lines
Identification of co-regulated genes during stress responses
Promoter analysis to identify enriched transcription factor binding motifs
Yeast one-hybrid screening to identify transcription factors that bind the At2g28370 promoter
Post-translational regulation mechanisms:
Transcription factors may regulate At2g28370 activity indirectly through:
Induction of miRNAs targeting At2g28370 mRNA
Expression of proteins that modify At2g28370 post-translationally
Regulation of At2g28370 protein turnover
A systems biology approach integrating transcriptomics, proteomics, and protein-protein interaction data would provide the most comprehensive understanding of how At2g28370 functions within transcriptional networks during stress responses.
Optimizing heterologous expression and purification of membrane proteins like At2g28370 requires careful consideration of multiple parameters:
Expression system selection:
E. coli systems: The commercial recombinant protein is expressed in E. coli . For optimal expression:
Use BL21(DE3) or C41/C43(DE3) strains specialized for membrane proteins
Consider fusion partners like MBP or SUMO to enhance solubility
Optimize induction conditions (temperature, IPTG concentration, induction time)
Eukaryotic alternatives:
Insect cell/baculovirus systems for better membrane protein folding
Yeast systems (P. pastoris or S. cerevisiae) for higher yields
Plant-based expression systems for native post-translational modifications
Expression optimization parameters:
| Parameter | Standard Condition | Optimization Range | Notes |
|---|---|---|---|
| Temperature | 37°C | 16-30°C | Lower temps reduce inclusion body formation |
| IPTG concentration | 1.0 mM | 0.1-0.5 mM | Lower concentrations may improve folding |
| Media | LB | TB, 2xYT, M9 | Richer media can increase yields |
| Induction OD | 0.6-0.8 | 0.4-1.2 | Optimization depends on strain and construct |
| Induction time | 4-6 hours | 3-18 hours | Longer at lower temperatures |
Purification strategy:
Cell lysis optimization (sonication vs. homogenization vs. detergent extraction)
Membrane solubilization with appropriate detergents (screen DDM, LDAO, OG)
Consider size exclusion chromatography as a polishing step
Quality control via SDS-PAGE, western blotting, and dynamic light scattering
Protein stabilization during purification:
Include glycerol (5-10%) in all buffers
Add protease inhibitors to prevent degradation
Maintain cold temperatures throughout purification
Consider using amphipols or nanodiscs for final preparation
Follow storage recommendations with 6% trehalose in Tris/PBS buffer at pH 8.0
Designing comprehensive experiments to elucidate At2g28370's role in stress response requires a multi-faceted approach:
Genetic manipulation studies:
Generate knockout/knockdown lines using CRISPR-Cas9 or RNAi
Create overexpression lines under constitutive and inducible promoters
Develop complementation lines with wild-type and mutated versions
Perform crosses with other stress response mutants to identify genetic interactions
Stress response phenotyping:
Subject transgenic lines to multiple stresses:
Abiotic: drought, salinity, heat, cold, oxidative stress
Biotic: bacterial, fungal, and viral pathogens
Measure physiological parameters:
Growth and developmental metrics
Water relations and ion content
Photosynthetic efficiency
ROS accumulation and antioxidant capacity
Compare responses across developmental stages
Molecular and biochemical analyses:
Transcriptome profiling:
RNA-Seq comparing wild-type vs. mutant under control and stress conditions
Time-course analysis to capture early and late responses
Proteome analysis:
Quantitative proteomics to identify differentially abundant proteins
Phosphoproteomics to detect signaling events
Metabolome analysis:
Target stress-related metabolites (proline, sugars, polyamines)
Untargeted metabolomics to identify novel pathways
Subcellular localization and trafficking:
Generate fluorescent protein fusions to track At2g28370 localization
Perform co-localization studies with organelle markers
Use FRAP (Fluorescence Recovery After Photobleaching) to study protein dynamics
Investigate changes in localization during stress responses
Integration of multiple datasets:
Combine transcriptomic, proteomic, metabolomic, and phenotypic data to construct comprehensive models of At2g28370 function in stress response networks, potentially revealing its role in the database of stress-responsive genes mentioned in the literature .