Recombinant Arabidopsis thaliana Probable inactive receptor kinase At1g27190 (At1g27190)

What is the probable inactive receptor kinase At1g27190?

The probable inactive receptor kinase At1g27190 is a protein encoded by the At1g27190 gene in Arabidopsis thaliana (mouse-ear cress). It is classified as a receptor-like kinase (RLK) and is characterized as "probable inactive," suggesting it may have altered or non-canonical kinase activity. The protein is part of the broader plant kinome involved in signal transduction pathways and is identified in UniProt with accession O04567 (UniProt ID: Y1719_ARATH) . In the Protein Ontology (PRO) database, it has the ID PR:O04567 with the short label "At-At1g27190" .

What are the basic structural features of At1g27190?

The At1g27190 protein is synthesized as a precursor that includes a signal peptide, indicating its processing through the secretory pathway. The protein contains:

• A leucine-rich repeat (LRR) domain typical of many plant receptor kinases

• A transmembrane region

• A cytoplasmic kinase domain

The coding sequence (CDS) of the gene spans positions 179-2011 in the mRNA sequence (XM_004238690.4) . The complete protein sequence consists of 610 amino acids, with the first few amino acids beginning with "ATGACAGCAAAATCAACTAACCCCATCTTCTTCTTCACTCTGTTCTTCCTCATTTTCACA" in the nucleotide sequence .

How is At1g27190 classified within the plant kinome?

At1g27190 belongs to the leucine-rich repeat receptor-like kinase (LRR-RLK) family, one of the largest groups of receptor kinases in plants. These kinases were analyzed in a phylogenetic study using ClustalW alignment of 352 positions corresponding to the kinase domain, with the phylogenetic tree reconstructed using the neighbor-joining method in the MEGA package v4.0 with 500 bootstrap resampling . This classification places At1g27190 among a group of related kinases involved in various signal transduction pathways in Arabidopsis.

What is the expression pattern of At1g27190 in Arabidopsis tissues?

At1g27190 shows expression across various Arabidopsis tissues, particularly in roots. According to transcriptome data from microarray experiments and RNA-seq analyses, this kinase is expressed in different tissues of the root meristem . The expression pattern can be visualized through databases such as the Arabidopsis Root Expression Database (www.arexdb.org), which was developed from studies by Birnbaum et al. (2003) and Brady et al. (2007) .

Expression data from multiple sources indicates that At1g27190 is not restricted to roots but is also expressed in other aerial tissues. This broad expression pattern suggests potential roles in multiple developmental or physiological processes throughout the plant.

How can researchers analyze the co-expression patterns of At1g27190?

Researchers can analyze co-expression patterns using several approaches:

• Microarray data analysis: Process data from microarray experiments available in repositories such as ArrayExpress (http://www.ebi.ac.uk/microarray-as/ae/), specifically focusing on experiments showing differential expression of RLKs in response to:

  • Abiotic stress (E-GEOD-3709)

  • Light treatment (E-GEOD-5617)

  • NaCl exposure (E-GEOD-7643)

  • IAA treatment (E-GEOD-18975)

• Clustering analysis: Genes can be clustered based on expression profiles to identify co-expressed gene clusters, which may indicate functional relationships .

• EXPLICIT-Kinase approach: This modified approach constructs a universal Arabidopsis gene expression predictor that can predict the expression of 30,172 non-kinase genes based on the expression of 994 protein kinase genes, including At1g27190 .

What are the recommended methods for studying At1g27190 gene function?

Several experimental approaches can be employed to study At1g27190 function:

For T-DNA insertion studies, seeds should be gas-sterilized in a desiccator for 2 hours with 100 ml of bleach (4% NaClO) mixed with 3 ml of HCl or surface-sterilized in 20% bleach for 20 minutes. Seeds should then be imbibed in sterile water containing 0.1% agarose for 3-4 days at 4°C in the dark before planting on standard medium (half-strength MS salt mixture, 1% sucrose, 0.5 g/l MES, pH 5.8, in 0.8% agar) .

How can researchers generate and validate recombinant At1g27190 protein?

To generate recombinant At1g27190 protein, researchers can follow this protocol:

• Clone selection: The coding sequence can be obtained from the NCBI Reference Sequence Database (RefSeq). For At1g27190, sequences with accession numbers like XM_004238690.3 or XM_004238690.4 represent the protein coding region .

• Expression vector: The open reading frame (ORF) sequence can be cloned into an expression vector such as pcDNA3.1+/C-(K)DYK, which adds a C-terminal DYKDDDDK (FLAG) tag for detection and purification .

• Cloning method: CloneEZ™ Seamless cloning technology can be used for inserting the sequence into the vector in the correct orientation .

• Expression and purification: The recombinant protein can be expressed in an appropriate host system (bacterial, insect, or mammalian cells) and purified using affinity chromatography targeting the C-terminal tag.

• Validation: Confirm protein expression and purification through Western blotting, mass spectrometry, and activity assays.

What phenotyping approaches are most informative for At1g27190 functional studies?

Root phenotyping approaches are particularly informative for studying At1g27190 function:

• Conditional phenotype assays: For these assays, plant 20 seeds per T-DNA insertion line alongside 20 wild-type control seeds. To minimize plate position effects, arrange seeds in alternate groups (10 wild-type followed by 10 mutant seeds in the top row, and 10 mutant followed by 10 wild-type seeds in the bottom row) .

• Root length measurements: After germination (verified by radicle presence), select seedlings that germinated simultaneously for quantitative root length measurements. A difference greater than 20% in root length between wild-type and mutant seedlings can be used as the qualitative criterion for scoring resistance or sensitivity to particular treatments .

• Microscopic analysis: Analyze roots after 4-8 days of growth using Nomarski optics and confocal microscopy to examine cellular organization and potential developmental abnormalities .

• Stress response testing: Evaluate root growth under various abiotic stress conditions, as LRR RLKs like At1g27190 play roles in signal transduction pathways related to hormone and abiotic stress responses .

How does the "probable inactive" designation affect research approaches for At1g27190?

The "probable inactive" designation for the receptor kinase At1g27190 has several implications for research approaches:

• Structural analysis: Researchers should examine the kinase domain for mutations in catalytic residues that might explain the predicted inactivity. This involves comparing the sequence with known active kinases to identify substitutions in key residues required for phosphotransfer reactions.

• Alternative functions: Despite being potentially catalytically inactive, the protein may still have important functions such as:

  • Acting as a scaffold for other signaling proteins

  • Functioning as a decoy receptor or competitor for ligands

  • Forming heterodimers with active kinases to modulate their function

• Evolutionary perspective: Investigate whether this predicted inactivity is conserved across species, which might indicate functional specialization rather than simply loss of function.

• Experimental validation: Design experiments to directly test kinase activity using in vitro phosphorylation assays with recombinant protein and appropriate substrates to confirm or refute the "probable inactive" annotation.

How can the EXPLICIT-Kinase approach be applied to understand At1g27190 function?

The EXPLICIT-Kinase approach provides a powerful framework for predicting At1g27190 function through gene expression analysis:

• Model construction: The EXPLICIT-Kinase model was constructed using 26,900 RNA-seq transcriptomes from 1,193 SRA studies. This model can predict the expression of 30,172 non-kinase genes based on the expression of 994 protein kinase genes .

• Accuracy validation: The model shows high prediction accuracy with correlation (r) values of 0.9930 and 0.9915 for root and shoot samples, respectively, slightly lower than the transcription factor-based predictor model (r values of 0.9949 and 0.9922) .

• Cross-validation: Using a 'leave-one-out-cross-validation' (LOOCV) strategy, the model demonstrates good prediction capability across various tissue types .

• Pathway association: By analyzing which genes and pathways At1g27190 expression best predicts, researchers can infer its potential functional roles in specific biological processes.

• Comparative analysis: Identify whether At1g27190 is a conserved predictor kinase between Arabidopsis and other plant species like maize, which would provide additional evidence for its role as a regulator of specific pathways .

What are the challenges in determining if At1g27190 forms part of a receptor complex?

Determining whether At1g27190 forms part of a receptor complex presents several challenges:

• Membrane protein interactions: As a membrane-localized receptor kinase, traditional protein-protein interaction methods may be challenging due to the hydrophobic nature of transmembrane domains.

• Transient interactions: Receptor complex formation may be transient or ligand-dependent, making detection difficult without the appropriate stimulus.

• Redundancy: Functional redundancy among related RLKs may mask phenotypes in single gene knockout studies, requiring multiple gene knockouts to observe clear phenotypes.

• Methodological approaches: Researchers should consider a combination of:

  • Co-immunoprecipitation studies with epitope-tagged proteins

  • Bimolecular fluorescence complementation (BiFC) for in vivo interaction studies

  • Förster resonance energy transfer (FRET) to detect proximity in living cells

  • Cross-linking followed by mass spectrometry to identify interaction partners

• Heterologous expression systems: Consider using systems like Nicotiana benthamiana for transient expression studies, as they may provide a more suitable environment for detecting plant receptor interactions than yeast or bacterial systems.

How can researchers integrate At1g27190 expression data with broader pathway information?

Researchers can integrate At1g27190 expression data with pathway information through several approaches:

• Coexpression network analysis: Identify genes that show similar expression patterns to At1g27190 across different conditions, which may indicate functional relationships or participation in common pathways.

• Gene Ontology (GO) enrichment: Analyze the GO terms associated with coexpressed genes to identify overrepresented biological processes, molecular functions, or cellular components.

• EXPLICIT-Kinase predictor analysis: The model identifies significant kinases as predictor kinases for predicting the expression of Arabidopsis genes and pathways. If At1g27190 is identified as a predictor kinase for specific pathways, this suggests potential regulatory roles .

• Cross-species comparison: Compare the function and expression patterns of At1g27190 with its orthologues in other plant species to identify conserved roles. The EXPLICIT-Kinase approach has revealed that portions of predictor kinases are shared and conserved between Arabidopsis and maize, providing additional evidence for their regulatory functions .

• Integration with stress response data: Analyze expression changes of At1g27190 in response to various stresses using publicly available datasets (e.g., E-GEOD-3709 for abiotic stress, E-GEOD-7643 for NaCl stress) .

What bioinformatic tools are most useful for studying At1g27190 and related receptor kinases?

Several bioinformatic tools are particularly useful for studying At1g27190 and related receptor kinases:

For phylogenetic analysis, researchers can align 352 positions corresponding to the kinase domain using ClustalW and reconstruct phylogenetic trees using the neighbor-joining method in MEGA v4.0 with 500 bootstrap resampling .

How can contradictory data about At1g27190 function be reconciled?

When faced with contradictory data about At1g27190 function, researchers should consider several approaches:

• Experimental conditions: Different growth conditions, developmental stages, or tissues used in studies can lead to apparently contradictory results. Carefully document and compare experimental conditions across studies.

• Genetic backgrounds: Variations in the genetic background of Arabidopsis lines can influence phenotypes. Consider using multiple alleles and complementation studies to confirm phenotypes are due to the targeted gene.

• Functional redundancy: At1g27190 may have partially redundant functions with other LRR-RLKs. Double or higher-order mutants might be necessary to observe clear phenotypes.

• Technical approaches: Different technical approaches (e.g., knockout vs. knockdown, constitutive vs. inducible systems) may yield different results. Consider using multiple complementary approaches to build a more comprehensive understanding.

• Quantitative analysis: Apply statistical methods appropriate for the specific data types to determine if apparent contradictions are statistically significant or within the range of experimental variation.

• Regulatory context: Consider that At1g27190 may have context-dependent functions, acting differently depending on the presence of other signaling components or environmental conditions.

What are the key considerations for researchers newly studying At1g27190?

Researchers beginning work with the probable inactive receptor kinase At1g27190 should consider several key aspects:

• The "probable inactive" designation suggests altered kinase activity, which may indicate non-canonical signaling mechanisms or regulatory functions rather than typical enzymatic activity.

• Utilize multiple complementary approaches, including genetic (T-DNA insertion mutants), molecular (recombinant protein production), and computational (EXPLICIT-Kinase modeling) methods to build a comprehensive understanding of At1g27190 function.

• Pay special attention to root phenotypes, as expression data suggests significant activity in root tissues, and established protocols exist for phenotypic analysis of root growth under various conditions.

• Consider potential functional redundancy with other LRR-RLKs, which may necessitate the generation of higher-order mutants to observe clear phenotypes.

• Integrate experimental data with bioinformatic analyses, including co-expression networks and cross-species comparisons, to place At1g27190 in a broader biological context.