Recombinant Bovine Carnitine O-palmitoyltransferase 1, muscle isoform (CPT1B)

What is the physiological role of CPT1B in fatty acid metabolism?

Carnitine palmitoyltransferase-1b (CPT1B) catalyzes the rate-limiting step of mitochondrial β-oxidation of long chain fatty acids (LCFAs), which are the most abundant fatty acids in mammalian membranes and energy metabolism . CPT1B facilitates the conjugation of carnitine to palmitoyl-CoA, enabling the transport of long-chain fatty acids across the mitochondrial membrane for subsequent oxidation and energy production. This process is particularly critical during periods of fasting, when most tissues depend heavily on fatty acid β-oxidation for cellular energy . The enzyme's activity directly controls the mitochondrial uptake of long-chain acyl-CoAs, making it a metabolic gatekeeper for energy production from fatty acids.

Unlike the liver isoform (CPT1A), CPT1B is predominantly expressed in tissues with high energy demands such as brown adipose tissue (BAT), heart, and skeletal muscle . This tissue-specific distribution reflects the importance of CPT1B in tissues that rely heavily on fatty acid oxidation for energy production. Notably, the activity and expression levels of CPT1B are influenced by nutritional status, hormonal regulation, species differences, and developmental stage .

How is CPT1B expression regulated at the genetic and molecular level?

CPT1B expression is governed by complex regulatory mechanisms that respond to metabolic demands. The gene encoding CPT1B is located on a separate chromosome from other CPT1 isoforms, allowing for independent regulation . At the transcriptional level, expression can be modulated by nutritional status and hormonal signals. Interestingly, studies have revealed that DNA methylation at the CPT1B promoter can blunt lipid-induced transcription, suggesting epigenetic regulation plays a significant role in CPT1B expression, particularly in obesity-related conditions.

In experimental models, heterozygous CPT1B+/− mice express approximately 50% of normal CPT1B mRNA levels in brown adipose tissue, heart, and skeletal muscles . This reduced expression correlates with corresponding decreases in protein content and enzymatic activity. Quantitative PCR techniques using specific primer pairs (forward: GACCATAGAGGCACTTCTCAGCATGG[FAM]C, reverse: GCAGCAGCTTCAGGGTTTGT) can accurately measure CPT1B expression levels in research settings .

Which expression systems yield optimal recombinant bovine CPT1B production?

Recombinant bovine CPT1B can be synthesized using several expression systems, each with distinct advantages. The choice of system should align with specific research requirements:

The bacterial system using E. coli provides cost-effective production but may lack critical post-translational modifications. For functional studies where native-like activity is essential, researchers should consider the baculovirus expression system, which better preserves the structural integrity and activity of mammalian proteins. Regardless of the expression system chosen, affinity chromatography purification is typically employed to isolate the recombinant protein.

What are proven methods for measuring CPT1B enzymatic activity?

Accurate assessment of CPT1B activity is essential for both characterizing recombinant proteins and understanding metabolic alterations in experimental models. The gold standard method involves a radiochemical forward assay measuring the formation of palmitoylcarnitine from palmitoyl-CoA and carnitine .

A detailed protocol based on the literature includes:

• Prepare tissue homogenates (10% w/v) in phosphate buffer (10 mM potassium phosphate/150 mM NaCl, pH 7.4) supplemented with protease inhibitor cocktail and protein phosphatase inhibitors .

• Conduct the assay by measuring the rate of palmitoylcarnitine formation from palmitoyl-CoA and carnitine .

• Extract the produced palmitoylcarnitine with water-saturated butanol, followed by re-extraction with butanol-saturated water .

• Quantify the product in the organic layer using scintillation counting .

This method provides highly reproducible results when conducted under standardized conditions. Researchers should note that activity measurements from recombinant sources may differ from native tissue due to variations in post-translational modifications and protein environment.

How does CPT1B deficiency affect embryonic development and survival?

Studies of CPT1B deficiency reveal its critical role in development and survival. Homozygous knockout of CPT1B (CPT1B−/−) is embryonically lethal, with embryos lost before embryonic day 9.5-11.5 . This early lethality underscores the essential role of CPT1B in embryonic development, likely due to its importance in energy metabolism during critical developmental stages.

In breeding experiments with heterozygous mice, significantly fewer CPT1B+/− offspring than expected are observed:

This marked deviation from Mendelian inheritance patterns (p<0.001 by chi-square test) suggests that even partial CPT1B deficiency can impact embryonic survival . When examining fetuses from sacrificed pregnant females, similar patterns emerge, with complete absence of CPT1B−/− fetuses. These findings suggest that CPT1B plays an indispensable role in energy metabolism during early development.

What phenotypes are associated with CPT1B haploinsufficiency in experimental models?

Heterozygous CPT1B+/− mice exhibit several distinct phenotypes that provide insight into the role of CPT1B in physiological adaptation. While these mice appear overtly normal with similar lifespans to wild-type littermates, they demonstrate:

• Cold intolerance: CPT1B+/− mice show impaired ability to maintain body temperature during cold exposure, suggesting compromised thermogenesis in brown adipose tissue .

• Increased susceptibility to cardiac stress: Under transverse aortic constriction (TAC)-induced left ventricular pressure overload, CPT1B+/− mice exhibit dramatically higher mortality rates than wild-type littermates, with most dying before completing two weeks of pressure overload .

• Exacerbated cardiac hypertrophy: Under mild pressure-overload conditions, CPT1B+/− mice develop more pronounced cardiac hypertrophy than wild-type mice, with greater increases in left ventricular mass and wall thickness .

Echocardiographic assessment reveals significant differences in cardiac parameters between wild-type and CPT1B+/− mice under pressure overload conditions:

These findings indicate that even partial reduction in CPT1B activity significantly compromises the heart's ability to adapt to mechanical stress .

How can recombinant CPT1B be used to investigate protein-protein interactions in mitochondrial metabolism?

Recombinant CPT1B serves as a valuable tool for investigating protein-protein interactions within mitochondrial metabolism networks. Recent research has revealed that CPT1B interacts with voltage-dependent anion channel 1 (VDAC1) and prolyl hydroxylase domain proteins (PHD2/3) to regulate fatty acid oxidation, particularly under varying oxygen conditions. These interactions represent an important regulatory mechanism linking metabolic pathways with oxygen sensing.

Investigators can employ several approaches to study these interactions:

• Co-immunoprecipitation assays using recombinant CPT1B with appropriate tags to pull down interaction partners

• Surface plasmon resonance to determine binding kinetics between CPT1B and potential partners

• Proximity ligation assays in cellular systems to visualize interactions in situ

• Isothermal titration calorimetry to measure thermodynamic parameters of binding interactions

When designing such experiments, researchers should consider that the membrane-associated nature of native CPT1B might affect interaction dynamics, potentially requiring specific detergents or membrane mimetics to maintain physiologically relevant conditions.

What role does CPT1B play in the cross-talk between fatty acid and glucose metabolism?

CPT1B functions as a metabolic switch point in the cross-talk between fatty acid and glucose utilization, particularly in tissues with high energy demands. The enzyme's activity directly influences substrate selection, with inhibition of CPT1B potentially shifting metabolism toward increased glucose utilization . This metabolic flexibility is especially important in cardiac tissue, where appropriate substrate selection is crucial for maintaining function under various physiological and pathological conditions.

Research using recombinant CPT1B can explore these regulatory networks by:

• Investigating how post-translational modifications of CPT1B respond to changing glucose availability

• Examining how CPT1B activity correlates with the expression and activity of key glycolytic enzymes

• Determining how CPT1B inhibition affects glucose uptake and utilization in different cell types

• Studying the effects of metabolic intermediates on CPT1B activity and stability

These investigations require careful experimental design that accounts for the complexity of metabolic networks, ideally combining in vitro enzymatic assays with cellular and in vivo models to establish physiological relevance.

What genotyping strategies are most effective for CPT1B research in animal models?

Accurate genotyping is essential for CPT1B research using animal models, particularly when working with heterozygous breeding schemes where homozygous knockouts are embryonically lethal. Based on established protocols, the following PCR-based strategy is recommended:

Standard PCR protocol for CPT1B genotyping:

• Extract tail DNA using standard procedures

• Perform PCR using PCR Master Mix (e.g., Roche, Indianapolis)

• For wild-type allele detection, use primer pair:

  • cpt1b-genoF1: CTACTGAAGATTGGGCTCCT

  • cpt-1bgenoR2: CAGCAATGGTGCAGGAATCT
    (Produces a 625 bp product)

• For mutant allele detection, use primer pair:

  • cpt1b-genoF1: CTACTGAAGATTGGGCTCCT

  • Neo-pR2: ACCGCTTCCTCGTGCTTTACGGTA
    (Produces a 440 bp product)

• Use annealing temperature of 58°C

This genotyping strategy enables clear distinction between wild-type, heterozygous, and (rarely detected) homozygous knockout animals, providing a reliable foundation for subsequent experimental work.

How should researchers design experiments to account for metabolic variations when studying CPT1B?

When designing experiments to study CPT1B function, researchers must account for various factors that affect metabolic parameters. Consider these methodological approaches:

• Control for circadian variations: CPT1B activity and fatty acid metabolism exhibit diurnal rhythms. Schedule sample collection and experimental interventions at consistent times.

• Standardize nutritional status: Fast animals for a defined period (e.g., 4-6 hours for mice) before tissue collection or experimental interventions to minimize variations from recent food intake.

• Account for sex differences: CPT1B expression shows sexual dimorphism in some tissues. For example, in mice, CPT1B is expressed in white adipose tissue of females but not males . Design experiments with appropriate sex-matching or analyze sexes separately.

• Comprehensive metabolic phenotyping: Complement CPT1B activity measurements with broader metabolic parameters:

  • Serum non-esterified fatty acids (NEFA) using enzymatic, colorimetric methods

  • Acylcarnitine profiles via electrospray tandem mass spectrometry

  • Urinary organic acid analysis

  • Glucose concentration measurements

• Stress testing protocols: Consider standardized challenges like cold exposure (4°C) with regular temperature monitoring to assess metabolic adaptability related to CPT1B function .

By implementing these methodological considerations, researchers can generate more reliable and reproducible data when investigating CPT1B function in experimental models.