Recombinant Bovine RING finger protein 148 (RNF148)

What is the basic structure and function of RNF148?

RNF148 is a RING finger protein that functions as an E3 ubiquitin ligase. The protein contains a protease-associated domain that is critical for its ability to bind target proteins such as CHAC2 . The RING domain facilitates the transfer of ubiquitin to substrate proteins, marking them for degradation by the proteasome. RNF148 has been identified as participating in protein-protein interactions within a larger network of interacting proteins, suggesting its role in multiple cellular pathways .

Methodologically, researchers studying the structure-function relationship of RNF148 typically employ techniques such as:

• Domain prediction and analysis using bioinformatics tools

• Recombinant protein expression and purification for structural studies

• Mutation studies targeting specific domains to assess functional changes

• Co-immunoprecipitation assays to identify binding partners

How does one express and purify recombinant RNF148 for experimental use?

Expression and purification of recombinant RNF148 typically involves:

• Selection of an appropriate expression system: While bacterial systems like E. coli are common, mammalian or insect cell expression systems may be preferable for proper folding and post-translational modifications .

• Vector construction: The RNF148 gene is cloned into an expression vector with an appropriate tag (e.g., GST, His, or rho-1D4) to facilitate purification .

• Expression optimization: Parameters such as induction time, temperature, and inducer concentration need optimization to maximize protein yield while maintaining proper folding.

• Purification strategy:

  • For GST-tagged RNF148: Glutathione affinity chromatography

  • For His-tagged RNF148: Immobilized metal affinity chromatography (IMAC)

  • Additional purification steps may include ion exchange and size exclusion chromatography

• Quality control: SDS-PAGE, Western blotting, and activity assays to confirm purity and functionality of the recombinant protein .

What experimental models are suitable for studying RNF148 function?

Based on current research, several experimental models have proven valuable for studying RNF148:

• Cell line models: Colorectal cancer cell lines such as SW48, RKO, and SW620 have been effectively used to study RNF148 function through overexpression and knockdown approaches .

• Animal models: BALB/c nude mice have been employed for in vivo studies, including subcutaneous xenograft models to assess tumor growth and peritoneal injection models to evaluate metastatic potential .

• Primary tissue cultures: Patient-derived colorectal cancer tissues can provide clinically relevant models for studying RNF148 expression and function.

Methodologically, researchers should:

• Select cell lines with low endogenous RNF148 expression for overexpression studies

• Use siRNA or CRISPR-Cas9 for knockdown/knockout studies

• Consider species-specific differences when translating findings between models

How does RNF148 specifically recognize and ubiquitinate its target proteins?

The mechanism of target recognition by RNF148 involves specific domain interactions. Research has shown that:

• Domain-specific binding: RNF148 uses its protease-associated domain to bind to the CHAC domain of CHAC2 .

• Residue-specific modifications: Critical phosphorylation and ubiquitination residues have been identified in CHAC2, with Y118 and K102 being the critical phosphorylation and ubiquitination residues, respectively .

• Interaction network: RNF148 operates within a broader network of interacting proteins that may influence substrate selection and ubiquitination efficiency .

To investigate these mechanisms, researchers typically employ:

• Yeast two-hybrid or mammalian two-hybrid assays to identify interacting domains

• Site-directed mutagenesis to alter specific residues and assess binding affinity

• In vitro ubiquitination assays to determine enzymatic activity

• Mass spectrometry to identify post-translational modifications

What is the relationship between RNF148 expression and chemotherapy resistance in cancer?

Research has demonstrated that RNF148 plays a significant role in modulating chemotherapy sensitivity, particularly to 5-fluorouracil (5-FU):

• Apoptosis regulation: RNF148 overexpression significantly reduces both spontaneous and 5-FU-induced apoptosis rates in colorectal cancer cells .

• Chemosensitivity modulation: Cells with RNF148 overexpression show decreased sensitivity to 5-FU, while knockdown of RNF148 significantly increases 5-FU sensitivity .

• Apoptotic marker expression: Tumors overexpressing RNF148 exhibit reduced levels of apoptotic markers such as active caspase-3 and cleaved PARP .

Methodologically, researchers investigating this relationship should consider:

• Cell viability assays (e.g., CCK-8) with varying drug concentrations

• Flow cytometry with Annexin V/FITC for apoptosis detection

• Western blot analysis of apoptotic pathway proteins

• Combination therapy approaches to overcome RNF148-mediated resistance

How does species variation in RNF148 structure affect its function and experimental applications?

While species-specific variations in RNF148 have not been extensively characterized in the search results, researchers working with bovine RNF148 should consider:

• Sequence homology: Perform comparative sequence analysis between bovine, human, and mouse RNF148 to identify conserved and variable regions.

• Functional domains: Assess conservation of critical domains, particularly the RING finger domain and protease-associated domain.

• Substrate specificity: Determine if bovine RNF148 targets the same substrates (e.g., CHAC2) as human RNF148, or if it has species-specific targets.

• Cross-reactivity of tools: Evaluate whether antibodies and other research tools developed for human or mouse RNF148 can be applied to bovine studies.

Methodologically, researchers should:

• Use bioinformatics tools for sequence alignment and structural prediction

• Develop species-specific antibodies if cross-reactivity is insufficient

• Perform comparative ubiquitination assays using recombinant proteins from different species

• Consider evolutionary aspects when interpreting functional differences

What are the optimal methods for detecting RNF148 expression in experimental and clinical samples?

Based on current research practices, several methods have proven effective for detecting RNF148:

• RT-PCR: Semi-quantitative RT-PCR using specific primers (e.g., RNF148F: GTGGAGTGTTCGGGAATCAT, RNF148R: GCAGCCAGGAAGGTAAATAG) with GAPDH as control .

• Western blot: Using RIPA buffer for protein extraction, followed by SDS-PAGE and immunoblotting with RNF148-specific antibodies at 1:1000 dilution .

• Immunohistochemistry (IHC): Using ChemMate EnVision detection kit for tissue samples, which allows visualization of protein expression patterns in different cell types and subcellular locations .

• qPCR: For more precise quantitative analysis of mRNA expression levels.

Methodologically, researchers should:

• Include appropriate positive and negative controls

• Validate antibody specificity, particularly for cross-species studies

• Normalize expression data to suitable reference genes

• Consider multiple detection methods for comprehensive analysis

How can researchers effectively model RNF148-dependent pathways in vitro?

To model RNF148-dependent pathways:

• Stable cell lines: Establish stable cell lines with controlled RNF148 expression through lentiviral or plasmid-based approaches .

• Inducible expression systems: Consider tetracycline-inducible systems for temporal control of RNF148 expression.

• Pathway analysis: Employ techniques such as RNA-seq or proteomics to identify downstream effectors of RNF148.

• Functional assays: Select appropriate assays based on the pathway of interest:

  • Colony formation assays for proliferation

  • Wound healing and transwell assays for migration

  • Flow cytometry for apoptosis analysis

  • Drug sensitivity assays for chemoresistance studies

• Co-culture systems: Develop co-culture systems to study cell-cell interactions influenced by RNF148.

How can RNF148 be targeted therapeutically, and what are the potential approaches?

Based on the oncogenic properties of RNF148, several therapeutic strategies could be considered:

• Small molecule inhibitors: Design inhibitors targeting the RING domain to disrupt E3 ligase activity.

• Peptide-based approaches: Develop peptides that interfere with RNF148-substrate interactions.

• Gene silencing: Employ siRNA or antisense oligonucleotides to reduce RNF148 expression.

• Combination therapies: Explore synergistic effects of RNF148 inhibition with conventional chemotherapies like 5-FU .

• Substrate stabilization: Develop approaches to prevent CHAC2 degradation despite RNF148 activity.

Methodologically, researchers should:

• Perform in silico modeling to identify potential binding sites

• Develop high-throughput screening assays for inhibitor discovery

• Validate hits using biochemical and cellular assays

• Test promising candidates in preclinical models

What is the significance of RNF148 as a biomarker in cancer diagnostics and prognosis?

Research has demonstrated that RNF148 has potential as a biomarker:

Methodologically, researchers exploring the biomarker potential of RNF148 should:

• Conduct retrospective and prospective clinical studies with adequate sample sizes

• Correlate RNF148 expression with established clinical parameters

• Perform multivariate analyses to establish independent prognostic value

• Develop standardized detection methods suitable for clinical application

What are the emerging techniques that could advance our understanding of RNF148 biology?

Several cutting-edge approaches could significantly enhance RNF148 research:

• CRISPR-Cas9 genome editing: For precise modification of RNF148 or its targets at endogenous loci.

• Proximity labeling: BioID or APEX2-based approaches to identify the RNF148 interactome in different cellular contexts.

• Single-cell analyses: To understand heterogeneity in RNF148 expression and function within tissues.

• Cryo-EM and structural biology: To determine the three-dimensional structure of RNF148 and its complexes.

• Organoid models: Patient-derived organoids to study RNF148 function in more physiologically relevant systems.

Methodologically, researchers should:

• Develop appropriate controls and validation strategies for new techniques

• Consider complementary approaches to corroborate findings

• Adapt existing protocols specifically for RNF148 research

• Collaborate across disciplines to integrate diverse technical expertise

How does the RNF148-CHAC2 axis integrate with broader cellular signaling networks?

Understanding the broader context of RNF148 function requires:

• Pathway integration: Investigate how the RNF148-CHAC2 axis intersects with established signaling pathways, such as endoplasmic reticulum stress and mitochondrial apoptosis pathways .

• Feedback mechanisms: Explore potential feedback loops regulating RNF148 expression and activity.

• Tissue-specific regulation: Examine how the RNF148-CHAC2 axis functions in different tissue contexts.

• Cross-talk with other E3 ligases: Investigate potential cooperation or competition with other ubiquitination systems.

Methodologically, researchers should consider:

• Systems biology approaches, including computational modeling

• Multi-omics integration (genomics, transcriptomics, proteomics)

• Perturbation studies with multiple pathway inhibitors

• Time-course experiments to capture dynamic regulation