Recombinant Bovine Transmembrane protein 14A (TMEM14A)

What is the basic structure and function of TMEM14A?

TMEM14A is a relatively small integral membrane protein consisting of 99 amino acids with three transmembrane domains. Its structure has been identified through nuclear magnetic resonance spectroscopy . The protein is primarily expressed in podocytes and plays a critical role in maintaining the integrity of the glomerular filtration barrier . Additionally, TMEM14A has been implicated in suppressing Bax-mediated apoptosis by preventing loss of mitochondrial membrane potential, suggesting a protective role against programmed cell death .

How is TMEM14A expression regulated in normal versus disease conditions?

TMEM14A expression shows distinct patterns in normal versus disease conditions. In kidney tissue, its expression is diminished before the onset of proteinuria in spontaneously proteinuric rat models . Interestingly, increased glomerular TMEM14A expression has been observed in various proteinuric renal diseases, suggesting a potential compensatory mechanism . In cancer research, TMEM14A has been found to be overexpressed in ovarian cancer tissues compared to normal tissues, as demonstrated by analysis of the Cancer Genome Atlas (TCGA) ovarian serous cystadenocarcinoma dataset . This differential expression pattern indicates that TMEM14A regulation may be tissue-specific and disease-dependent.

What are the predominant experimental models used to study TMEM14A function?

Several experimental models have been employed to investigate TMEM14A function:

• Rodent models: Studies have utilized both Dahl and SHR rat strains to investigate the relationship between TMEM14A expression and the development of proteinuria .

• Zebrafish embryo models: Researchers have employed zebrafish to study the functional role of TMEM14A in glomerular filtration barrier integrity. The zebrafish homologue of TMEM14A (zgc:163080) can be knocked down using morpholino injection to block mRNA translation, followed by dextran tracer injections to assess glomerular permeability .

• Cell culture systems: Various cell lines including immortalized podocytes, HEK293 cells, and human umbilical vein endothelial cells (HUVEC) have been used to measure TMEM14A expression and investigate its cellular localization . Cancer cell lines, particularly ovarian cancer lines like CAOV3, have been utilized to study TMEM14A's role in cancer progression .

What techniques are most effective for studying TMEM14A interactions with other proteins in the glomerular filtration barrier?

For investigating TMEM14A interactions with other glomerular proteins, several advanced techniques can be employed:

• Co-immunoprecipitation (Co-IP): This method can identify direct protein-protein interactions by precipitating TMEM14A along with its binding partners from cell lysates. Based on research protocols, using appropriate antibodies against TMEM14A followed by mass spectrometry analysis of co-precipitated proteins can reveal its interaction network .

• Proximity ligation assay (PLA): This technique can detect protein interactions in situ within tissue sections, providing spatial information about where TMEM14A interacts with other proteins in the glomerular filtration barrier.

• RNA interference combined with proteomic analysis: As demonstrated in the research, RNAi-mediated knockdown of TMEM14A followed by proteomic analysis can reveal changes in the expression levels of other proteins, indicating potential functional relationships . This approach has been successfully used in studies examining TMEM14A's role in ovarian cancer cells, where lentiviral vectors carrying siRNAs targeting specific regions of human TMEM14A were employed .

• Immunohistochemistry with co-localization analysis: Research has utilized semiquantitative scoring of TMEM14A staining in podocytes (scale 0-4) to evaluate its expression pattern and co-localization with other podocyte markers .

How can researchers effectively design experiments to investigate TMEM14A's role in preventing apoptosis?

To investigate TMEM14A's anti-apoptotic function, researchers should consider the following experimental design:

• Gene manipulation strategies: Utilize RNA interference (siRNA) or CRISPR-Cas9 techniques to knock down or knock out TMEM14A expression, respectively. For overexpression studies, lentiviral-mediated vectors have proven effective, as demonstrated in ovarian cancer cell studies .

• Apoptosis assays: Flow cytometric analysis can be used to examine cell apoptosis rates following TMEM14A manipulation . Additionally, measurements of mitochondrial membrane potential will be valuable since TMEM14A has been described to prevent apoptosis by maintaining mitochondrial membrane potential through Bax suppression .

• Bax interaction studies: Since TMEM14A has been implicated in Bax suppression, researchers should investigate direct or indirect interactions between TMEM14A and Bax using co-immunoprecipitation or proximity ligation assays.

• In vivo validation: Following in vitro findings, validation in appropriate animal models is crucial. For renal studies, rat models (such as Dahl rats) showing spontaneous proteinuria development can be valuable . For cancer research, xenograft mouse models have been successfully used to quantify the role of TMEM14A in vivo .

• Pathway analysis: Chromatin immunoprecipitation assays can determine connections between TMEM14A and transcription factors like c-Myc, which has been demonstrated in ovarian cancer research .

What are the methodological challenges in producing functional recombinant bovine TMEM14A for structural studies?

Producing functional recombinant transmembrane proteins like bovine TMEM14A presents several challenges:

• Expression system selection: For membrane proteins, specialized expression systems such as insect cells (Sf9, Sf21) or mammalian cells may be more appropriate than bacterial systems to ensure proper folding and post-translational modifications.

• Solubilization and purification: TMEM14A, being a membrane protein with three transmembrane domains, requires careful selection of detergents for solubilization. Mild detergents that maintain native protein conformation should be employed during purification.

• Protein stability: Recombinant TMEM14A may have limited stability outside its native membrane environment. Incorporation into nanodiscs, liposomes, or amphipols can help maintain its native conformation for structural studies.

• Functional validation: Assays must be developed to confirm that the recombinant protein retains its native function. Based on TMEM14A's known functions, these could include assays for Bax interaction, mitochondrial membrane potential preservation, or effects on apoptotic pathways .

• Structural analysis considerations: For structural studies like NMR (which has been successfully used for TMEM14A structure determination) or X-ray crystallography, specialized approaches for membrane proteins such as lipidic cubic phase crystallization may be necessary .

How can TMEM14A be targeted in experimental models of proteinuric kidney disease?

Based on research findings, TMEM14A plays a protective role in maintaining glomerular filtration barrier integrity, suggesting several targeting strategies:

• Gene therapy approaches: Since knockdown of TMEM14A mRNA translation results in proteinuria in zebrafish embryos, gene therapy to maintain or increase TMEM14A expression might protect against proteinuria development .

• Expression modulation: In experimental rat models, TMEM14A expression is diminished before proteinuria onset, suggesting that early intervention to maintain its expression could be protective . Researchers could employ viral vectors for podocyte-specific expression of TMEM14A.

• Signaling pathway targeting: Identifying the signaling pathways that regulate TMEM14A expression could provide indirect targets. Research shows that TMEM14A expression varies significantly between different age groups in rat models, suggesting developmental regulation that could be therapeutically exploited .

• Combination therapy: Since increased glomerular TMEM14A expression is observed in proteinuric renal diseases (potentially as a compensatory mechanism), combining TMEM14A-targeted therapy with conventional antiproteinuric treatments might enhance efficacy .

• Monitoring methodology: Semiquantitative scoring of TMEM14A staining (scale 0-4) can be used to monitor intervention efficacy in experimental models .

What is the relationship between TMEM14A expression and cancer progression, particularly in ovarian cancer?

Research demonstrates a complex relationship between TMEM14A and cancer progression:

• Expression correlation: TMEM14A is overexpressed in ovarian cancer tissues compared to normal tissues, and its expression positively correlates with mortality rates in ovarian cancer patients .

• Cellular mechanisms: TMEM14A inhibits ovarian cancer cell apoptosis while accelerating their energy metabolism, including both glycolysis and oxygen respiration . These effects contribute to cancer cell survival and growth.

• Molecular pathways: TMEM14A shows positive correlation with c-MYC expression in ovarian cancer. Overexpression of c-Myc can rescue the function of TMEM14A, suggesting a mechanistic relationship between these factors .

• Functional impacts: Gene Set Enrichment Analysis (GSEA) reveals that TMEM14A is correlated with cell cycle and metastasis pathways . Knockdown of TMEM14A expression by RNAi inhibits proliferation and invasion of ovarian cancer cells .

• Clinical relevance: TMEM14A has been proposed as both a diagnostic and prognostic biomarker candidate for early detection of ovarian cancer and improving clinical management of patients .

How does TMEM14A function differ across species, and what are the implications for using animal models?

Understanding cross-species differences in TMEM14A function is crucial for translational research:

• Structural conservation: While the search results don't specifically address bovine TMEM14A, the protein structure (99 amino acids with three transmembrane domains) appears to be conserved across species examined in research .

• Zebrafish model applicability: The zebrafish homologue of TMEM14A (zgc:163080) has functional similarity to mammalian TMEM14A, as knockdown results in proteinuria, suggesting conserved function in glomerular filtration barrier maintenance .

• Rat models: Studies in Dahl and SHR rat strains show that TMEM14A expression patterns correlate with proteinuria development, with significant expression differences between strains . This suggests species-specific and strain-specific regulation.

• Expression patterns: In rats, glomerular TMEM14A mRNA expression is significantly higher at younger ages and decreases with time, indicating developmental regulation that may vary across species .

• Methodological considerations: When using animal models, species-specific primers must be designed for gene expression analysis. For example, in rat studies, Hprt1 was used as an internal control for TMEM14A expression analysis, while different housekeeping genes may be appropriate for other species .

What are the optimal conditions for analyzing TMEM14A expression in tissue samples?

Based on research protocols, the following methodological approaches are recommended:

• RNA isolation and expression analysis:

  • For tissue samples, TRIzol-based RNA isolation followed by reverse transcription using AMV reverse transcriptase has been effectively used

  • Quantitative real-time PCR (qPCR) with SYBR green chemistry is recommended for expression analysis

  • Appropriate housekeeping gene selection is crucial: GAPDH for cell culture experiments and Hprt1 for purified rat glomeruli experiments

• Protein detection:

  • Immunohistochemistry using specific anti-TMEM14A antibodies with semiquantitative scoring on a scale of 0-4 has been successfully employed

  • The scoring system evaluates podocyte staining: no staining (0), 0%-10% of podocytes (1), 10%-30% of podocytes (2), 30%-60% of podocytes (3), and more than 60% of podocytes (4)

• Tissue preparation and fixation:

  • For immunohistochemistry, paraffin embedding after appropriate fixation is recommended

  • For RNA extraction from specific cell populations, techniques like laser capture microdissection may be necessary to isolate specific cell types expressing TMEM14A

• Statistical analysis:

  • Student's unpaired t-testing for comparisons between two or three groups

  • One-way ANOVA with Tukey's post hoc analysis when more than three groups are compared

  • P-value below 0.05 is considered significant

What functional assays best demonstrate TMEM14A's role in cellular metabolism?

To investigate TMEM14A's role in cellular metabolism, the following functional assays are recommended:

• Energy metabolism assessment:

  • Oxygen consumption and extracellular acidification measurements using Seahorse XF24 analyzer, as demonstrated in ovarian cancer research

  • This approach can quantify both glycolytic activity and oxygen respiration in cells with modified TMEM14A expression

• Proliferation assays:

  • Cell Counting Kit-8 (CCK-8) assay has been effectively used to examine cell proliferation following TMEM14A manipulation

  • Cells should be seeded in 96-well plates and maintained for various time points (0, 12, 24, and 48 h) before analysis

• Apoptosis evaluation:

  • Flow cytometric analysis is recommended for examining cell apoptosis rates following TMEM14A silencing or overexpression

  • This should be combined with mitochondrial membrane potential measurements given TMEM14A's role in preventing mitochondrial membrane potential loss

• Cell cycle analysis:

  • Since TMEM14A has been implicated in regulating cell cycle transitions, flow cytometry-based cell cycle analysis is valuable

  • GSEA analysis has revealed correlation between TMEM14A and cell cycle pathways

• Invasion assays:

  • Matrix-based invasion assays should be considered to assess TMEM14A's impact on cell invasiveness, which has been documented in cancer studies

How can researchers effectively design knockdown and overexpression systems for TMEM14A functional studies?

Based on published methodologies, the following approaches are recommended:

• RNA interference (RNAi):

  • Design siRNAs targeting distinctive regions of TMEM14A. Successfully used targets include: TAGCACTGTCACCTCTAATAT; AAGCTTAAACTACAACTTGTC; AAGTGGAGTTCACAGAATGAT

  • Lentiviral plasmid (pLKO.1) with siRNAs (1,000 ng) can be used for stable knockdown

  • Transfection efficacy should be verified by RT-qPCR once the lentivirus transfection rate exceeds 80%

• Overexpression systems:

  • Lentiviral-mediated vectors have been successfully used for TMEM14A overexpression

  • The viral titer should be determined by collecting supernatant after centrifugation at 70,000 × g at 4°C for 2 h

  • Target cells should be cultured with diluted lentiviruses and screened for transfection rate after 72 h

• In vivo models:

  • For zebrafish studies, morpholino injection to block TMEM14A mRNA translation is effective

  • The functional impact can be assessed by injecting a mixture of 3 and 70 kDa dextran tracers and quantifying proximal tubule reabsorption droplets

• Controls and validation:

  • Include appropriate positive controls (e.g., puromycin aminonucleoside for inducing proteinuria in zebrafish models)

  • Verify knockdown or overexpression at both mRNA and protein levels

  • Perform rescue experiments to confirm specificity (e.g., overexpression of c-Myc rescued the function of TMEM14A in cancer studies)

What is the potential for TMEM14A as a biomarker in kidney and cancer diseases?

TMEM14A shows significant promise as a biomarker in multiple disease contexts:

• Kidney disease applications:

  • TMEM14A expression is diminished before proteinuria onset in rat models, suggesting potential as an early predictive biomarker for proteinuric kidney disease

  • Increased glomerular TMEM14A expression in various proteinuric renal diseases indicates its potential as a diagnostic marker

  • The protein's expression pattern in podocytes could serve as a marker for podocyte health in kidney biopsies

• Cancer biomarker potential:

  • TMEM14A is overexpressed in ovarian cancer tissues compared to normal tissues

  • Its expression positively correlates with mortality rates in ovarian cancer patients

  • It has been recognized as both a diagnostic and prognostic biomarker candidate for early detection of ovarian cancer

  • TMEM14A's correlation with c-MYC expression provides additional diagnostic value through multi-marker panels

• Methodological considerations:

  • For kidney diseases, semiquantitative scoring of TMEM14A immunostaining provides a standardized approach for biomarker evaluation

  • For cancer applications, quantitative PCR and immunohistochemical staining assays have been successfully applied to determine expression patterns in clinical samples

How might TMEM14A interact with other membrane proteins in the mitochondria to regulate cellular energy production?

TMEM14A's localization in mitochondria suggests important roles in energy metabolism regulation:

• Mitochondrial interactions:

  • As TMEM14A localizes in mitochondria and has been shown to affect both glycolysis and oxygen respiration in cancer cells, it likely interacts with components of the electron transport chain

  • Its role in preventing loss of mitochondrial membrane potential through Bax suppression suggests potential interactions with mitochondrial permeability transition pore components

• Metabolic regulation:

  • TMEM14A inhibits cancer cell apoptosis while accelerating energy metabolism, including both glycolysis and oxygen respiration

  • This dual effect on both anaerobic and aerobic metabolism suggests interactions with key regulatory proteins in both pathways

• Research approaches:

  • Proximity-based labeling techniques (BioID, APEX) can identify proteins in close proximity to TMEM14A within mitochondria

  • Seahorse XF24 analyzer measurements can determine the specific impact of TMEM14A on different aspects of mitochondrial function

  • Proteomic analysis following TMEM14A manipulation can reveal changes in expression levels of other mitochondrial proteins

• Therapeutic implications:

  • Understanding TMEM14A's role in mitochondrial function could reveal new targets for diseases where energy metabolism is dysregulated

  • In cancer, targeting TMEM14A might disrupt the metabolic adaptations that support tumor growth

What are the challenges and opportunities in developing TMEM14A-targeted therapeutics for proteinuric kidney diseases?

The development of TMEM14A-targeted therapeutics presents unique challenges and opportunities:

• Therapeutic opportunities:

  • Since TMEM14A plays a protective role in maintaining glomerular filtration barrier integrity, enhancing its expression or activity could potentially prevent or treat proteinuria

  • The protein's diminished expression before proteinuria onset suggests a window for preventive intervention

  • Its primarily podocyte-specific expression allows for targeted delivery approaches

• Challenges in drug development:

  • As a transmembrane protein, TMEM14A may have limited druggable sites accessible to conventional small molecule approaches

  • The specific mechanisms by which TMEM14A maintains filtration barrier integrity remain incompletely understood

  • Targeting a protein with multiple functions may lead to unintended consequences, particularly given its role in cancer progression

• Potential approaches:

  • Gene therapy to maintain or enhance TMEM14A expression specifically in podocytes

  • Small molecules that stabilize TMEM14A or enhance its protective functions

  • Peptide mimetics of functional TMEM14A domains

  • Targeting upstream regulators of TMEM14A expression or downstream effectors of its function

• Translational considerations:

  • Animal models like the zebrafish embryo system provide efficient platforms for initial therapeutic screening

  • The significant difference in TMEM14A expression between Dahl and SHR rat strains suggests genetic or regulatory factors that could be leveraged therapeutically

  • The compensatory increase in TMEM14A expression in proteinuric states suggests complex regulatory mechanisms that need to be understood for effective therapeutic targeting