Recombinant Bovine Transmembrane protein 70, mitochondrial (TMEM70)

What is the primary function of TMEM70 in mitochondrial bioenergetics?

TMEM70 is crucially involved in the biogenesis of mitochondrial ATP synthase. While the exact protein function has not been fully characterized, research indicates it plays an essential role in the assembly of the ATP synthase complex, particularly the c8-ring component that forms part of the enzyme's rotor in the membrane domain . ATP synthase is responsible for converting the proton motive force across the inner mitochondrial membrane into the chemical energy stored in ATP molecules. TMEM70 deficiency results in significant reduction of ATP synthase content (up to 70-80% reduction), while maintaining some residual assembly (approximately 20-30% of normal levels) .

What are the structural characteristics and cellular localization of TMEM70?

TMEM70 is a 21 kD protein encoded by the TMEM70 gene located on chromosome 8q21.11, containing 3 exons . The protein is primarily located in the inner mitochondrial membrane, where it can interact with specific subunits of the ATP synthase complex, particularly subunit c . Ultrastructural studies of mitochondria in TMEM70-deficient tissues reveal distinctive morphological abnormalities including swollen degenerated mitochondria with lipid crystalloid inclusions, cristae aggregation, and even exocytosis of mitochondrial material .

What experimental models are available for studying TMEM70 function?

Several experimental models have been developed to study TMEM70 function:

• Cell culture models: Patient-derived fibroblasts with TMEM70 mutations provide valuable tools for in vitro studies .

• Rodent models: Both rat and mouse knockout models have been established:

  • SHR-Tmem70^ko/ko^ (spontaneously hypertensive rat model) results in embryonic lethality

  • Transgenic rescue models expressing wild-type Tmem70 under the control of the EF-1α universal promoter have been generated

• In vitro reconstitution systems: Biochemical studies with recombinant proteins to investigate protein-protein interactions, particularly between TMEM70, TMEM242, and ATP synthase components .

These models allow for detailed investigations of TMEM70 function in different physiological contexts and experimental paradigms.

How do TMEM70 and TMEM242 cooperate in ATP synthase assembly?

Recent research has revealed that TMEM70 works in concert with another transmembrane protein, TMEM242, to facilitate the assembly of the c8-ring of ATP synthase. Their cooperative roles can be understood through the following experimental findings:

• Protein interactions: Mass spectrometry analysis shows that both TMEM70 and TMEM242 interact with subunit c of ATP synthase . When tagged TMEM242 (TMEM242-t) is expressed in HEK293 cells, it associates with TMEM70 and, to a lesser extent, with subunit c and membrane subunits of complex I (NDUFC2, ND2, and ND3) .

• Assembly defects in knockout models:

  • TMEM242 deletion affects, but does not completely eliminate, ATP synthase assembly

  • TMEM70 deletion has a similar effect on ATP synthase assembly

  • Combined deletion of both TMEM70 and TMEM242 prevents assembly of ATP synthase entirely

• Differential effects on subunit incorporation: Interestingly, removal of TMEM242, but not TMEM70, affects the incorporation of subunits ATP6, ATP8, j, and k into the enzyme complex .

• Native gel analyses: In affinity-purified samples, both TMEM70-t and TMEM242-t appear in complexes with subunit c of different molecular masses:

  • TMEM70-t comigrates with a subunit c complex of approximately 150 kDa

  • TMEM242-t comigrates with subunit c complexes of 60-100 kDa

These findings suggest that TMEM70 and TMEM242 have both overlapping and distinct roles in ATP synthase assembly, particularly in facilitating the proper incorporation of the c8-ring rotor component.

What is the relationship between TMEM70 and the mitochondrial complex I assembly (MCIA) complex?

Beyond its role in ATP synthase assembly, TMEM70 appears to have connections to the assembly of respiratory complex I through interactions with the MCIA complex:

• Protein interactions: Tagged TMEM70 (TMEM70-t) expressed in HEK293 cells associates significantly with MCIA complex components including:

  • ACAD9 (acyl-CoA dehydrogenase family member 9)

  • ECSIT (evolutionarily conserved signaling intermediate in Toll pathway)

  • NDUFAF1 (NADH:ubiquinone oxidoreductase complex assembly factor 1)

  • TMEM126B (transmembrane protein 126B)

• Complex I subunit associations: TMEM70-t also shows significant association with membrane domain subunits of complex I, including NDUFB10, NDUFB11, NDUFC2, and ND2 .

• Complex I deficiency in knockout models: Deletion of TMEM70 diminishes complex I content relative to wild-type cells, while the content of complexes II, III, and IV remains largely unaffected .

• Synergistic effects: Combined deletion of TMEM70 and TMEM242 enhances the impact on complex I assembly beyond what is observed with individual deletions .

These findings suggest that TMEM70 may have a broader role in organizing the assembly of multiple respiratory chain complexes beyond ATP synthase, potentially through coordinating activities with the MCIA complex.

What methodologies are effective for rescuing TMEM70 deficiency in experimental models?

The development of genetic complementation approaches has shown promise for rescuing TMEM70 deficiency:

• Transgenic rescue in animal models: Studies in SHR-Tmem70^ko/ko^ rats demonstrate that expression of wild-type Tmem70 transgene under the EF-1α universal promoter can rescue the otherwise lethal phenotype .

• Tissue-specific complementation efficiency:

• Expression level requirements: Importantly, even partial restoration of TMEM70 protein (16-49% of control levels) is sufficient for full biochemical complementation in some tissues, suggesting that complete restoration of TMEM70 expression may not be necessary for therapeutic benefit .

• In vitro complementation: Expression of wild-type TMEM70 in patient fibroblasts lacking the TMEM70 protein has been shown to restore ATP synthase content and function as well as mitochondrial ATP production .

These findings provide critical insights for developing potential therapeutic approaches for TMEM70 deficiency in humans.

What are the genotype-phenotype correlations in TMEM70 deficiency?

Understanding the relationship between specific TMEM70 mutations and clinical manifestations is crucial for diagnosis and treatment:

• Common mutations: The c.317-2A>G mutation in the TMEM70 gene is particularly prevalent among patients of Roma (Gypsy) ethnic background and is often found in homozygous form in consanguineous families .

• Clinical presentation spectrum: Despite harboring identical mutations, affected siblings can display significantly different clinical outcomes, ranging from:

  • Death within 60 hours after birth

  • Recurrent life-threatening metabolic crises that can be successfully managed with treatment

• Ultrastructural findings: Electron microscopy examination of muscle tissue from TMEM70-deficient patients reveals distinctive mitochondrial abnormalities:

  • Accumulation of swollen degenerated mitochondria

  • Lipid crystalloid inclusions

  • Cristae aggregation

  • Exocytosis of mitochondrial material

• Biochemical characteristics: Patients typically present with:

  • Almost complete ATP synthase deficiency

  • 3-methylglutaconic aciduria

  • Metabolic acidosis

  • Hyperammonemia during metabolic crises

These correlations can guide genetic counseling and inform clinical management strategies for patients with TMEM70 mutations.

What are optimal experimental conditions for studying TMEM70's protein interactions?

Based on published research methodologies, the following approaches have proven effective for investigating TMEM70's interactions:

• Affinity purification combined with mass spectrometry:

  • Expression of tagged TMEM70 (TMEM70-t) in HEK293 cells allows for identification of binding partners

  • This approach has successfully identified interactions with ACAD9, ECSIT, NDUFAF1, and TMEM126B

• Immunodetection of copurified proteins:

  • Western blotting of TMEM70-t purified complexes confirmed interactions with ACAD9, NDUFAF1, and TIMMDC1

  • Subunit c of ATP synthase was also detected in association with TMEM70-t

• Native gel electrophoresis:

  • Allows visualization of TMEM70-containing complexes of different molecular masses

  • TMEM70-t has been detected in oligomers around and beyond 1,236 kDa

  • TMEM70-t comigrates with a subunit c complex of approximately 150 kDa

• Quantitative PCR for transgene expression analysis:

  • For transgenic models, primers specific to vector Tmem70 cDNA (lacking introns) can be used

  • Example primers: F-GGCAGGCTGATTTATACTGGGA (exon 1) and R-AAGGCTGACCACACTTGTAGA (exon 2)

  • Standard reaction conditions with SYBR Green Master Mix and calculation using the 2^-ΔΔCt^ relative quantification method

These methodological approaches provide a framework for researchers to study TMEM70's complex interactions within the mitochondrial membrane environment.

What treatment approaches have shown efficacy for ATP synthase deficiency due to TMEM70 mutations?

Despite the severity of ATP synthase deficiency, some therapeutic interventions have shown promise:

• Metabolic support therapy: Patients with recurrent metabolic crises have been successfully managed with:

  • Supplementation of anaplerotic amino acids

  • Lipid supplementation

  • Symptomatic treatment during metabolic crises

• Genetic complementation approach: Experimental evidence suggests that even partial restoration (16-49% of normal levels) of TMEM70 protein expression can lead to significant or complete biochemical complementation in some tissues .

• Rationale for gene therapy feasibility:

  • TMEM70 defects do not completely disrupt ATP synthase biogenesis (20-30% of assembled enzyme remains in patients and animal models)

  • Full recovery of ATP production may be possible with only partial increase in ATP synthase content

  • The expression of wild-type TMEM70 in patient fibroblasts has been shown to restore ATP synthase content and function

These findings suggest that TMEM70 deficiency may be a promising target for gene therapy approaches, with the potential for significant clinical benefit even with partial restoration of protein function.

What are the optimal detection methods for TMEM70 protein in research applications?

Based on available research tools, the following methods are effective for TMEM70 detection:

• Western blot analysis: Commercial antibodies are available for TMEM70 detection, with recommended dilutions of 1:1000-1:4000. Validation has been performed in multiple cell lines, including A2780 and Jurkat cells .

• Immunohistochemistry: TMEM70 can be detected in tissue samples such as human liver tissue using commercial antibodies. Recommended antigen retrieval methods include:

  • TE buffer at pH 9.0

  • Alternative: citrate buffer at pH 6.0

• Genetic testing:

  • For mutation detection: Sanger sequencing using primers like TMEM70-3.1fw_4692 (gcactGTATTTATGGTTTGATTTTG) and TMEM70-3.1rv_4692 (ATGCCGTTTCTCTTCACTGG)

  • For transgene expression: qPCR with primers designed to specifically amplify from vector Tmem70 cDNA containing no introns

These validated methods provide researchers with reliable approaches for detecting and quantifying TMEM70 in various experimental contexts.

How can researchers differentiate between the effects of TMEM70 deficiency on ATP synthase versus other respiratory complexes?

Distinguishing the primary effects on ATP synthase from secondary effects on other respiratory complexes requires careful experimental design:

• Biochemical analysis of individual complexes:

  • Blue native electrophoresis allows visualization of all assembled respiratory complexes

  • Enzymatic activity assays specific to each complex can quantify functional impairment

  • SDS-PAGE followed by immunoblotting with antibodies against subunits of different complexes can reveal specific protein deficiencies

• Comparative knockout studies:

  • Single knockout models (ΔTMEM70 or ΔTMEM242) versus double knockout (ΔTMEM70/ΔTMEM242)

  • Analysis shows that TMEM70 deletion primarily affects ATP synthase with lesser effects on complex I

  • Combined deletion of TMEM70 and TMEM242 enhances the impact on complex I

• Interaction network analysis:

  • Affinity purification of tagged TMEM70 followed by mass spectrometry reveals interactions with both ATP synthase components and MCIA complex components

  • This suggests direct mechanisms by which TMEM70 might influence both ATP synthase and complex I assembly

These approaches allow researchers to differentiate between primary defects in ATP synthase assembly and secondary consequences on the respiratory chain.

What are the critical knowledge gaps in understanding TMEM70 function?

Despite significant advances, several important questions about TMEM70 remain unanswered:

• The precise molecular mechanism by which TMEM70 facilitates c8-ring assembly in ATP synthase

• The structural features of TMEM70 that mediate its interactions with ATP synthase subunits and other proteins

• The regulatory mechanisms controlling TMEM70 expression and activity

• The relative contribution of ATP synthase deficiency versus complex I impairment to the pathophysiology of TMEM70-related disorders

• The tissue-specific requirements for TMEM70 function and the basis for variable clinical presentations among patients with identical mutations

Addressing these knowledge gaps through continued research will be essential for developing targeted therapeutic approaches for patients with TMEM70 deficiency.

What emerging technologies might advance TMEM70 research?

Several cutting-edge approaches hold promise for advancing our understanding of TMEM70:

• Cryo-electron microscopy: Could reveal the structural basis of TMEM70's interactions with the c8-ring and other assembly factors

• CRISPR-mediated genome editing: For creating precise disease models and potential therapeutic approaches

• Single-cell omics: To understand the heterogeneity of mitochondrial function in TMEM70-deficient tissues

• In vivo gene therapy approaches: Building on the successful transgenic rescue in animal models to develop clinical therapies

• Mitochondrial proteomics: To comprehensively map the dynamic protein interactions of TMEM70 during ATP synthase assembly

These technologies may help bridge current knowledge gaps and accelerate the development of treatments for TMEM70-related disorders.