KEGG: cju:C8J_0494
Succinyl-CoA ligase (sucC) functions as the beta subunit of the succinyl-CoA ligase complex in the tricarboxylic acid (TCA) cycle of Campylobacter jejuni. This enzyme catalyzes the reversible conversion of succinyl-CoA to succinate coupled with ADP phosphorylation to generate ATP. In C. jejuni, this reaction is particularly important because the organism relies exclusively on amino acids as carbon sources rather than glucose, making the TCA cycle central to energy generation .
The protein typically operates as part of a heterodimeric enzyme with the alpha subunit (sucD). Structurally, sucC contains conserved nucleotide-binding domains characteristic of other bacterial succinyl-CoA ligases. The protein likely contains a CoA-binding domain and a nucleotide-binding domain, with catalytic residues positioned at the interface between these domains.
Research methodologies for studying sucC structure include X-ray crystallography, cryo-electron microscopy, and computational modeling. Functional characterization typically involves enzyme activity assays measuring ATP formation or succinyl-CoA consumption under varying conditions.
Multiple expression systems have been utilized for the production of recombinant C. jejuni proteins, each with distinct advantages depending on research goals:
| Expression System | Advantages | Considerations | Typical Yield |
|---|---|---|---|
| E. coli | High yield, simplicity, cost-effective | May require codon optimization | 5-15 mg/L |
| Yeast | Post-translational modifications | Longer production time | 3-10 mg/L |
| Baculovirus | Better for larger proteins | More complex setup | 2-8 mg/L |
| Mammalian Cell | Authentic folding and modifications | Highest cost, lowest yield | 0.5-3 mg/L |
For optimal expression in E. coli systems, researchers should consider BL21(DE3) strains with pET vector systems, as these have shown good expression levels for C. jejuni proteins . The gene should ideally be codon-optimized for E. coli expression to overcome potential rare codon issues.
Methodologically, purification is typically facilitated by using an N-terminal histidine tag, with optimization of induction conditions (temperature, IPTG concentration, induction time) being critical for maximizing soluble protein yield. For proteins with solubility challenges, fusion partners such as MBP or SUMO may enhance solubility.
C. jejuni's unique metabolic landscape makes sucC particularly significant compared to its role in other bacteria. Unlike most bacteria, C. jejuni lacks the ability to utilize glucose and other carbohydrates as carbon sources, instead relying on amino acids that feed into the TCA cycle . This makes the TCA cycle, including the sucC-catalyzed reaction, critical for energy generation.
The TCA cycle in C. jejuni functions as a complete oxidative cycle, unlike in some anaerobic bacteria where it operates partially or in reverse. Other TCA cycle enzymes, such as the dual-functioning fumarate reductase (Frd), which serves as the sole succinate dehydrogenase in C. jejuni, have been studied in greater detail than sucC . The Frd enzyme contains three subunits and plays a crucial role in the oxidation of succinate to fumarate, a key step in the oxidative TCA cycle.
Research approaches to compare sucC with other TCA cycle enzymes include:
Metabolic flux analysis using isotope-labeled amino acids
Growth studies with specific enzyme mutants under various conditions
Comparative genomics and phylogenetic analysis across bacterial species
Enzyme kinetics studies comparing recombinant proteins from different sources
Investigating sucC's contribution to C. jejuni pathogenesis requires sophisticated experimental approaches:
Genetic manipulation studies:
Construction of ΔsucC deletion mutants using homologous recombination
Complementation with wild-type or mutated sucC variants
Site-directed mutagenesis of catalytic residues to create enzymatically inactive variants
Conditional expression systems to control sucC expression timing
Host-pathogen interaction models:
Intestinal epithelial cell adhesion and invasion assays
Macrophage survival and replication studies
Galleria mellonella infection model for rapid virulence assessment
Mouse colonization models with wild-type and ΔsucC strains
Metabolic analyses in infection-relevant conditions:
Metabolomic profiling during host cell interaction
Measurement of energy charge and redox state during infection
Isotope labeling to track carbon flow through the TCA cycle in vivo
Comparative analysis with other TCA cycle enzyme mutants
Systems biology approaches:
Transcriptomic analysis of wild-type versus ΔsucC strains during infection
Proteomics to identify interaction partners during infection process
Network analysis to position sucC in pathogenicity-associated pathways
Comparative genomics across strains with varying virulence
These approaches should be integrated to distinguish between direct virulence contributions and indirect effects due to altered metabolism. For example, recent studies with other metabolic enzymes in C. jejuni have demonstrated that elevated energy metabolism is closely related to high pathogenicity characterized by frequent colonization and severe intestinal inflammation in mice .
Evaluating sucC as a vaccine candidate requires systematic assessment through several experimental phases:
Antigen preparation and characterization:
Production of highly purified recombinant sucC (>95% purity)
Endotoxin removal to <0.1 EU/μg protein using validated methods
Structural verification through circular dichroism or thermal shift assays
Epitope prediction and mapping using computational and experimental approaches
Immunization studies:
Formulation testing with various adjuvants (aluminum salts, oil-in-water emulsions)
Dose-response assessment to determine optimal antigen concentration
Comparison of administration routes (subcutaneous, intramuscular, mucosal)
Prime-boost schedules optimization for maximum response
Immune response characterization:
Antibody titer measurement by ELISA at multiple timepoints
Isotype and subclass distribution analysis
T-cell response assessment (proliferation, cytokine production)
Functional antibody testing (neutralization, opsonization)
Protection assessment:
Challenge studies in appropriate animal models
Measurement of bacterial load reduction in intestinal tissues
Assessment of symptom severity and duration
Cross-protection testing against heterologous C. jejuni strains
Recent research has demonstrated that metabolic enzymes can serve as effective vaccine targets. For example, QcrC, a subunit of menaquinol cytochrome c reductase complex in C. jejuni, has shown promise as a vaccine antigen. Subcutaneous immunization with recombinant QcrC induced C. jejuni-specific serum IgG antibody production and significantly suppressed both oxygen consumption rate and growth of C. jejuni .
When evaluating sucC as a vaccine candidate, researchers should include appropriate controls, such as adjuvant-only groups, irrelevant protein controls of similar size, and pre-immune sera for baseline measurements.
Distinguishing between catalytic and potential non-catalytic (moonlighting) functions of sucC requires carefully designed experimental approaches:
Structure-function analysis:
Site-directed mutagenesis of catalytic residues (based on structural predictions)
Construction of domain deletion variants to isolate functional regions
Creation of chimeric proteins with domains from different species
Point mutations that alter substrate specificity without affecting structure
Comparative phenotypic analysis:
Side-by-side assessment of wild-type, deletion mutant, and catalytically inactive mutant
Growth kinetics under various stress conditions (oxygen limitation, nutrient restriction)
Metabolomic profiling to differentiate metabolic from non-metabolic effects
Host cell interaction studies with all variants
Protein interaction studies:
Pull-down experiments with wild-type and catalytically inactive sucC
Bacterial two-hybrid screening to identify interaction partners
Cross-linking followed by mass spectrometry to map protein-protein interactions
Comparative interactome analysis between active and inactive variants
Localization and trafficking analysis:
Subcellular fractionation to identify unexpected compartmentalization
Fluorescent protein fusions to track localization under different conditions
Surface display analysis of wild-type and mutant proteins
Immunogold electron microscopy for high-resolution localization
| Experimental Approach | Key Question Addressed | Expected Results for Moonlighting Function |
|---|---|---|
| Catalytic mutant phenotyping | Is the phenotype dependent on enzymatic activity? | Phenotype persists despite loss of catalytic function |
| Heterologous complementation | Can another enzyme replace sucC? | Only full sucC complements all functions |
| Protein interaction mapping | Does sucC interact with non-metabolic proteins? | Interactions persist in catalytically dead mutants |
| Abnormal localization studies | Is sucC found in unexpected cellular locations? | Presence in membrane fractions or secreted forms |
A similar approach has been used to study other C. jejuni proteins, such as the QcrC protein, where specific monoclonal antibodies were developed to target functional molecules conserved across multiple C. jejuni strains but not expressed by related species .
Environmental conditions significantly influence C. jejuni metabolism and virulence, making systematic assessment of sucC expression and function under varying conditions crucial:
Environmental variation experiments:
Temperature ranges relevant to host and environment (4°C, 37°C, 42°C)
Oxygen tension variations (microaerobic, aerobic, anaerobic)
Nutrient limitation studies (amino acid restriction, metal limitation)
pH gradients reflecting intestinal conditions (pH 5.5-8.0)
Bile salt exposure mimicking intestinal environment
Expression analysis techniques:
Quantitative RT-PCR for transcript level measurement
Western blotting with specific antibodies for protein quantification
Translational reporter fusions (luciferase, GFP) for real-time monitoring
Proteomics for global protein expression patterns
Single-cell analysis to detect population heterogeneity
Functional assessment approaches:
Enzyme activity assays under different environmental conditions
Growth rate determination in various media formulations
Metabolite profiling using LC-MS/MS
Oxygen consumption rate measurements
ATP production quantification
Regulatory network analysis:
Promoter mapping and activity assessment
Chromatin immunoprecipitation to identify regulatory proteins
Transcription start site determination using 5' RACE
Mutational analysis of potential regulatory elements
Research with other TCA cycle enzymes in C. jejuni has demonstrated significant changes in expression and activity under different culture conditions. For example, studies have shown that the metabolic activity of C. jejuni changed significantly in different culture conditions, particularly decreasing when C. jejuni was grown on agar compared to liquid media . These changes correlated with altered virulence properties, suggesting environmental sensing mechanisms link metabolism to pathogenicity.
Investigating the interactions between C. jejuni sucC and the host immune system requires multifaceted experimental approaches:
In vitro immune cell stimulation:
Exposure of dendritic cells, macrophages, or PBMCs to purified recombinant sucC
Measurement of cytokine/chemokine production by ELISA or multiplexed assays
Analysis of cell surface activation markers by flow cytometry
Transcriptomic profiling to identify immune pathways activated by sucC
Antigenicity and immunogenicity assessment:
Epitope mapping using overlapping peptide libraries
HLA binding prediction and validation
T cell epitope identification through ELISpot assays
B cell epitope mapping using antibody binding studies
Host response to sucC during infection:
Comparison of immune responses to wild-type and ΔsucC mutant strains
Measurement of sucC-specific antibodies in infected hosts
Histopathological examination of infected tissues
Immune cell infiltration and activation analysis
Molecular interaction studies:
Investigation of potential interactions with pattern recognition receptors
Assessment of inflammasome activation potential
Studies of antigen processing and presentation pathways
Analysis of signaling pathway activation in host cells
Similar studies with other C. jejuni proteins have yielded valuable insights. For example, research with QcrC showed that subcutaneous immunization with recombinant protein induced C. jejuni-specific serum IgG antibody production that significantly suppressed bacterial growth . When comparing approaches, researchers should consider using fragment-based analysis as well as whole-protein studies, as different domains may interact differently with immune components.
Accurate assessment of recombinant C. jejuni sucC enzymatic activity requires specialized protocols tailored to its function in the TCA cycle:
Forward reaction (Succinyl-CoA → Succinate) assay:
Spectrophotometric monitoring of ADP → ATP conversion
Coupled enzyme system using pyruvate kinase and lactate dehydrogenase
NADH oxidation measurement at 340 nm
Reaction buffer: 50 mM HEPES (pH 7.5), 5 mM MgCl₂, 1 mM DTT, 0.1 mM ATP
Reverse reaction (Succinate → Succinyl-CoA) assay:
Measurement of CoA incorporation using DTNB (Ellman's reagent)
Absorbance monitoring at 412 nm
Reaction buffer: 50 mM Tris-HCl (pH 8.0), 5 mM MgCl₂, 100 mM KCl, 1 mM CoA
Enzyme kinetics determination:
Substrate concentration ranges: 0.05-5 mM succinyl-CoA or succinate
Temperature optimization (typically 37°C for C. jejuni enzymes)
pH profiling (pH 6.0-9.0)
Metal cofactor optimization (Mg²⁺, Mn²⁺)
Quality control measures:
Verification of recombinant protein purity (>95% by SDS-PAGE)
Confirmation of proper folding via circular dichroism
Size exclusion chromatography to verify oligomeric state
Thermal shift assays to assess stability
| Parameter | Forward Reaction | Reverse Reaction | Notes |
|---|---|---|---|
| Typical Km | 0.2-0.5 mM (succinyl-CoA) | 1-5 mM (succinate) | Values are estimates based on similar enzymes |
| Vmax calculation | ΔA340/min using extinction coefficient of NADH (6220 M⁻¹cm⁻¹) | ΔA412/min using extinction coefficient of TNB (14,150 M⁻¹cm⁻¹) | Adjust for any dilution factors |
| Specific activity | μmol product/min/mg protein | μmol product/min/mg protein | Reported at saturating substrate concentrations |
| Common inhibitors | Oxaloacetate, ATP (high conc.) | NaF, high CoA concentrations | Use as controls to verify specific activity |
For accurate activity measurements, researchers should ensure that the beta subunit (sucC) is either co-expressed or reconstituted with the alpha subunit (sucD), as the complete enzyme is a heterodimer. Similar approaches have been used to study the enzymatic activity of other C. jejuni metabolic enzymes, such as the fumarate reductase and succinate dehydrogenase enzymes .
Researchers frequently encounter several challenges when purifying recombinant C. jejuni sucC protein:
Solubility issues:
Challenge: Formation of inclusion bodies in E. coli expression systems
Solutions:
Lower induction temperature to 16-20°C
Use solubility-enhancing fusion tags (MBP, SUMO, TrxA)
Co-express with chaperones (GroEL/ES, DnaK/J)
Express in specialized strains (ArcticExpress, Rosetta-gami)
Stability concerns:
Challenge: Activity loss during purification
Solutions:
Add glycerol (10-20%) to all buffers
Include reducing agents (1-5 mM DTT)
Maintain cold temperature throughout purification
Add protease inhibitors to prevent degradation
Co-purification requirements:
Challenge: Need for co-purification with alpha subunit (sucD)
Solutions:
Co-expression from bicistronic construct
Sequential purification of both subunits followed by reconstitution
Tandem affinity purification using different tags on each subunit
Native purification maintaining existing complexes
Contaminating activities:
Challenge: Host enzyme activities masking sucC function
Solutions:
Multiple purification steps (IMAC followed by ion exchange)
Activity assays with specific inhibitors
Control assays with heat-inactivated enzyme
Comparison with purified enzyme from commercial sources
| Purification Strategy | Typical Yield | Purity | Activity Retention | Notable Considerations |
|---|---|---|---|---|
| Single-step IMAC | 8-12 mg/L | 85-90% | 70-80% | Fastest method but moderate purity |
| IMAC + Size Exclusion | 5-8 mg/L | >95% | 75-85% | Better separation of oligomeric states |
| MBP fusion | 15-20 mg/L | 80-85% | 65-75% | Higher solubility but potential MBP interference |
| Co-expression with sucD | 3-6 mg/L | 85-90% | 85-95% | Lower yield but higher activity |
Similar challenges have been reported when purifying other C. jejuni proteins. For example, when working with QcrC, researchers were able to produce functional recombinant protein for immunization studies, which successfully induced C. jejuni-specific antibodies .
Effective primer design is critical for successful cloning and expression of C. jejuni sucC, requiring consideration of several key factors:
Basic primer design principles:
Length: 18-30 nucleotides for gene-specific regions
GC content: 40-60% for optimal annealing
Melting temperature (Tm): 55-65°C with <5°C difference between primer pairs
Avoid secondary structures: Check for self-complementarity and hairpin formation
Terminal G/C: Include 1-2 G/C nucleotides at 3' end for stable annealing
Cloning-specific considerations:
Restriction enzyme sites: Add 5-6 nucleotide overhangs before restriction sites
Reading frame preservation: Carefully calculate to maintain correct translation
Vector compatibility: Match restrictions sites with chosen expression vector
Kozak sequence: Include appropriate translation initiation context
Removal of internal restriction sites: Consider synonymous mutations if needed
Expression optimization elements:
Affinity tags: Include sequences for His, FLAG, or other purification tags
Protease cleavage sites: Add TEV or thrombin sites for tag removal
Codon optimization: Modify sequences for E. coli preferred codons
Fusion partners: Consider adding solubility enhancers (MBP, SUMO)
Signal sequences: Include if secretion or membrane targeting is desired
C. jejuni-specific considerations:
High AT content: Design primers to avoid AT-rich regions if possible
Codon usage: C. jejuni has different codon bias than E. coli
Secondary structures: Check for potential structures in template DNA
Gene verification: Design sequencing primers every 500-700 bp
Example primer design for sucC amplification and cloning:
| Primer Purpose | Sequence (5' to 3') | Features |
|---|---|---|
| Forward with NdeI | GCGCATATGATGXXXXXXXXXXXXX | GCGC (overhang), CATATG (NdeI), ATG (start codon) |
| Reverse with XhoI | GCGCTCGAGTTAXXXXXXXXXX | GCGC (overhang), CTCGAG (XhoI), TTA (stop codon) |
| Forward for His-tag | GCGCATATGCATCATCATCATCATCATATGXXXXX | Includes 6xHis sequence after start codon |
| Sequencing primer 1 | XXXXXXXXXXXXXXXXXXXXXXX | Targets ~500 bp into gene |
| Sequencing primer 2 | XXXXXXXXXXXXXXXXXXXXXXX | Targets ~1000 bp into gene |
When designing primers, researchers should verify them using tools like Primer-BLAST to check for specificity, OligoAnalyzer for secondary structure prediction, and NEBcutter for restriction site analysis.
Rigorous experimental controls are critical when evaluating the effects of sucC knockout on C. jejuni pathogenicity:
Genetic complementation controls:
Wild-type complementation: Reintroduction of native sucC gene
Plasmid-only control: Empty vector to control for plasmid effects
Site-specific complementation: Insertion at original locus vs. ectopic
Heterologous complementation: sucC from related species
Phenotypic validation controls:
Growth curve analysis in multiple media formulations
Metabolomic profiling to verify expected metabolic changes
Enzyme activity assays to confirm loss of sucC function
Whole transcriptome analysis to detect compensatory changes
In vitro pathogenicity controls:
Wild-type strain from same background
Unrelated knockout with known pathogenicity effects
Multiple independent sucC knockout clones
Control for growth rate differences in interpretation
In vivo model controls:
Mock-infected animals
Animals infected with heat-killed bacteria
Competitive index assays (wild-type vs. mutant co-infection)
Histopathological analysis with blinded scoring
Similar approaches have been used when studying other metabolic genes in C. jejuni. For example, when evaluating the role of QcrC in pathogenicity, researchers found that mouse intestine colonized by C. jejuni with high QcrC expression showed the greatest intestinal inflammation, demonstrating the link between metabolic function and pathogenicity .
A particularly important consideration for sucC studies is the potential for polar effects when creating knockout mutants, as sucC is likely part of an operon with other genes. Researchers should verify that observed phenotypes are specifically due to sucC deletion rather than downstream effects on co-transcribed genes.
The impact of sucC mutations on C. jejuni metabolism and virulence varies significantly across environmental conditions:
Metabolic consequences of sucC mutation:
Disruption of the TCA cycle leading to altered energy production
Accumulation of upstream metabolites (e.g., succinyl-CoA)
Potential rerouting of carbon flow through alternative pathways
Changes in redox balance affecting electron transport chain function
Environmental condition effects:
Temperature-dependent phenotypes (37°C human host vs. 42°C avian host)
Oxygen tension response (microaerobic environments vs. oxygen-limited niches)
Nutrient availability adaptation (amino acid-rich vs. nutrient-poor conditions)
Stress response variations (acid stress, bile salt exposure, oxidative stress)
Virulence factor modulation:
Altered motility affecting host colonization capacity
Changes in adhesion and invasion properties
Modified biofilm formation ability
Variations in stress resistance affecting survival in host
Host-specific adaptations:
Different colonization patterns in various host species
Altered persistence in environmental reservoirs
Changed transmission efficiency between hosts
Varied immune response elicitation
Recent studies with other metabolic genes in C. jejuni have demonstrated that metabolic enzyme expression levels can significantly impact pathogenicity. For example, researchers found that elevated expression of QcrC, a component of the respiratory chain, correlated with increased colonization frequency and more severe intestinal inflammation in mice . Similar relationships likely exist for sucC, where expression levels may vary in response to environmental conditions, affecting both metabolic capacity and virulence potential.
When studying sucC mutations, researchers should examine effects across a comprehensive range of conditions rather than in a single laboratory setting, as phenotypes may only become apparent under specific environmental stresses.
Analyzing the evolution of sucC across Campylobacter species requires sophisticated bioinformatic approaches:
Sequence-based evolutionary analysis:
Multiple sequence alignment using MUSCLE, MAFFT, or Clustal Omega
Phylogenetic tree construction using Maximum Likelihood or Bayesian methods
Selection pressure analysis through dN/dS ratio calculation
Identification of conserved domains and catalytically important residues
Structural bioinformatics:
Homology modeling using solved crystal structures as templates
Molecular dynamics simulations to assess functional impacts of variations
Evolutionary conservation mapping onto 3D structures
Protein-protein interaction interface prediction
Genomic context analysis:
Operon structure comparison across species
Synteny mapping to identify genomic rearrangements
Horizontal gene transfer detection using composition-based methods
Regulatory element identification in promoter regions
Functional prediction tools:
Gene ontology term enrichment analysis
Protein family classification using HMM profiles
Metabolic pathway reconstruction and comparison
Network-based functional prediction approaches
| Analysis Tool | Application | Output | Interpretation |
|---|---|---|---|
| PAML (codeml) | Selection analysis | ω (dN/dS) values | ω < 1: purifying selection; ω > 1: positive selection |
| ConSurf | Conservation mapping | Residue conservation scores | Identifies functionally important regions |
| I-TASSER | Structure prediction | 3D models with confidence scores | Provides structural context for sequence variations |
| STRING | Interaction network | Protein-protein interaction predictions | Reveals functional associations conserved across species |
Similar approaches have been applied to other C. jejuni proteins. For example, researchers compared QcrC amino acid sequences between C. jejuni and C. coli to identify species-specific differences and epitope regions that could be targeted by antibodies specifically reactive to C. jejuni but not related species .
High-throughput screening for sucC inhibitors requires sophisticated methodologies that balance throughput with accuracy:
Primary screening assays:
Coupled enzyme spectrophotometric assays measuring NADH oxidation
Fluorescence-based assays tracking ATP production
Bioluminescence detection of ADP formation via luciferase coupling
Thermal shift assays to identify compounds that bind and stabilize sucC
Counter-screening and validation:
Testing against purified enzyme from related bacteria for selectivity
Screening against human ATP citrate lyase to identify host toxicity
Validation in alternate assay formats to eliminate false positives
Dose-response curves to determine IC50 values
Whole-cell antimicrobial assays:
Growth inhibition assessment in microaerobic conditions
Resazurin-based viability determination
Bioluminescent reporter strains for real-time monitoring
Time-kill kinetics to determine bacteriostatic vs. bactericidal activity
Advanced characterization techniques:
Mode of inhibition determination (competitive, non-competitive)
Surface plasmon resonance to measure binding kinetics
Isothermal titration calorimetry for thermodynamic parameters
X-ray crystallography of enzyme-inhibitor complexes
| Screening Approach | Throughput | Advantages | Limitations | Success Metrics |
|---|---|---|---|---|
| Spectrophotometric assay | 10,000-50,000 cpds/day | Direct activity measurement | Interference from colored compounds | Z' > 0.7, CV < 10% |
| Thermal shift | 50,000-100,000 cpds/day | Detects binding independent of mechanism | Binding doesn't always affect function | ΔTm > 2°C |
| Whole-cell growth | 5,000-20,000 cpds/day | Identifies compounds with cell penetration | Non-specific toxicity | Selectivity index > 10 |
| ATP biosensor | 20,000-80,000 cpds/day | High sensitivity | Indirect measure of activity | Signal:background > 5:1 |
Recent studies with other C. jejuni enzymes have demonstrated the potential of targeting metabolic functions. For example, researchers have shown that antibodies targeting QcrC could suppress the oxygen consumption rate and growth of C. jejuni , suggesting that small molecule inhibitors of key metabolic enzymes like sucC could similarly affect bacterial viability.
Integrating structural biology approaches provides critical insights into sucC function in C. jejuni:
Structure determination methodologies:
X-ray crystallography for high-resolution static structures
Cryo-electron microscopy for larger complexes or flexible regions
NMR spectroscopy for dynamics and ligand-binding studies
Small-angle X-ray scattering for solution conformation analysis
Computational structure analysis:
Molecular dynamics simulations to study conformational changes
Normal mode analysis to identify functional movements
Molecular docking to predict substrate and inhibitor binding
Electrostatic surface mapping to identify interaction interfaces
Structure-guided functional studies:
Site-directed mutagenesis based on structural insights
Hydrogen-deuterium exchange mass spectrometry for dynamic regions
Disulfide cross-linking to validate predicted domain movements
FRET-based assays to measure conformational changes
Complex formation analysis:
Chemical cross-linking coupled with mass spectrometry
Blue native PAGE to identify native complexes
Single-particle analysis of multi-protein assemblies
Integrative modeling combining multiple data sources
Similar structural biology approaches have been applied to other C. jejuni proteins. For example, researchers used computational structure prediction tools like AlphaFold to model the three-dimensional structure of QcrC fragments and predict the effects of single-point mutations on antibody binding . These studies revealed key residues involved in species-specific recognition by monoclonal antibodies.
For sucC, structural studies would be particularly valuable for understanding its interaction with the alpha subunit (sucD), substrate binding determinants, and potential allosteric regulation sites. Combining structural data with enzymatic assays and in vivo studies provides a comprehensive understanding of how structure dictates function in the cellular context.
Evaluating sucC as a diagnostic biomarker requires systematic assessment against established diagnostic performance criteria:
Analytical performance evaluation:
Sensitivity calculation using ROC curve analysis (target: >90%)
Specificity determination against related species (target: >95%)
Limit of detection establishment (target: <10³ CFU/mL)
Reproducibility assessment (coefficient of variation <15%)
Clinical validation parameters:
Positive and negative predictive values in relevant populations
Performance across different sample types (stool, food, environmental)
Comparison with gold standard culture methods
Time-to-result versus conventional methods
Technical considerations:
Stability under various storage and handling conditions
Adaptability to point-of-care testing formats
Potential for multiplexing with other biomarkers
Cost-effectiveness compared to existing methods
Implementation factors:
Ease of sample preparation requirements
Compatibility with existing laboratory workflows
Equipment requirements and complexity
Potential regulatory pathways and requirements
Research on other C. jejuni proteins has shown promise for diagnostic applications. For example, QcrC was found to be conserved among C. jejuni strains including clinical isolates, but not expressed by related species such as C. coli and C. fetus, making it a potential diagnostic target .
When evaluating sucC as a biomarker, researchers should consider both antigen detection approaches (detecting the protein itself) and serological approaches (detecting host antibody responses to sucC). Each approach has different applications, with antigen detection suitable for acute diagnosis and antibody detection more appropriate for epidemiological studies or post-infection diagnosis.