Choristoneura biennis, commonly known as the two-year-cycle budworm moth, is a species of moth belonging to the family Tortricidae. It is native to Canada, specifically found in Alberta and British Columbia . The species has a wingspan of approximately 26 mm, with adults typically emerging in July . C. biennis is a specialist herbivore feeding primarily on conifers, with larvae consuming Abies lasiocarpa (subalpine fir), Picea engelmanni (Engelmann spruce), and Picea glauca (white spruce) .
The ecological significance of C. biennis stems from its position in the Choristoneura genus, which includes several notable forest pests. While less infamous than its relative C. fumiferana (spruce budworm), understanding C. biennis biology contributes to our comprehension of conifer forest ecology and pest dynamics in North American ecosystems.
Cytochrome c oxidase subunit 2 (COII) is one of several mitochondrial genes commonly used in molecular phylogenetic studies of Lepidoptera. Unlike some other mitochondrial markers, COII provides several advantages:
Evolutionary rate: COII evolves at an intermediate rate, making it particularly useful for resolving relationships at both species and genus levels.
Conserved regions: COII contains sections that are highly conserved across Lepidoptera, facilitating primer design for PCR amplification.
Variable regions: Despite conserved sections, COII also possesses regions with sufficient variability to distinguish closely related species within genera like Choristoneura.
Size and manageability: The COII gene is of moderate length, making it relatively easy to sequence and analyze compared to longer mitochondrial regions.
COII has been effectively used in phylogenetic studies of Tortricidae, complementing other mitochondrial markers such as COI (the barcode region) and 16S rRNA .
Choristoneura biennis has the following taxonomic classification:
| Taxonomic Rank | Classification |
|---|---|
| Domain | Eukaryota |
| Kingdom | Animalia |
| Phylum | Arthropoda |
| Class | Insecta |
| Order | Lepidoptera |
| Family | Tortricidae |
| Genus | Choristoneura |
| Species | C. biennis |
| Binomial name | Choristoneura biennis Freeman, 1967 |
This species is formally recognized as Choristoneura occidentalis biennis, a subspecies within the broader Choristoneura spruce budworm complex .
Choristoneura biennis belongs to the conifer-feeding group of Nearctic Choristoneura species. Phylogenetic analyses based on mitochondrial DNA suggest that:
C. biennis is closely related to other North American conifer feeders including C. fumiferana, C. pinus, and C. occidentalis occidentalis .
It is more distantly related to broad-leaf feeding Choristoneura species like C. rosaceana and C. conflictana .
The genus Choristoneura appears to have originated in the Holarctic region approximately 23 million years ago, with major diversification occurring around 16 million years ago .
The evolutionary history of Choristoneura shows two main clades: a primarily Nearctic clade (including C. biennis) and a predominantly Palearctic clade .
Cladogenesis in the genus appears to have been synchronized with herbivorous specialization, with each clade divided into coniferophagous or polyphagous lineages .
Recombinant expression of C. biennis COII provides several research advantages:
Protein structure analysis: Enables structural studies without extracting limited quantities from natural sources.
Functional characterization: Facilitates investigation of enzymatic properties and substrate specificity.
Antibody production: Recombinant proteins can be used to generate specific antibodies for immunodetection studies.
Comparative biochemistry: Allows comparison of COII properties between C. biennis and other Choristoneura species to understand adaptations.
Evolutionary studies: Recombinant proteins can be modified to test hypotheses about the functional significance of amino acid substitutions observed in evolutionary comparisons.
The optimal expression system for recombinant C. biennis COII depends on research objectives:
Bacterial Expression Systems (E. coli):
Advantages: Fast growth, high yield, cost-effective, well-established protocols
Limitations: Lack of post-translational modifications, potential for inclusion body formation
Recommended strains: BL21(DE3) for basic expression; Rosetta or CodonPlus strains for addressing codon bias issues
Insect Cell Expression Systems:
Advantages: Proper folding, post-translational modifications similar to native protein
Recommended: Sf9 or High Five™ cells with baculovirus expression vectors
Considerations: COII is a membrane protein, so expression with appropriate membrane-targeting signals is essential
Yeast Expression Systems:
Advantages: Eukaryotic processing, good for membrane proteins
Recommended: Pichia pastoris for high-density culture and inducible expression
Cell-Free Expression Systems:
Advantages: Bypasses toxicity issues, direct incorporation of labeled amino acids
Particularly useful for structural studies requiring isotopic labeling
For studies focused on structure-function relationships, insect cell systems are preferable despite higher costs and technical complexity.
Differentiating C. biennis from other Choristoneura species requires an integrated approach:
Sequence-Based Differentiation:
PCR amplification and sequencing of the COII gene
Alignment with reference sequences
Identification of species-specific nucleotide polymorphisms
Key Nucleotide Positions for Differentiation:
While specific COII polymorphisms for C. biennis are not detailed in the search results, mitochondrial DNA analysis has been successfully used for species delimitation within the Choristoneura genus .
Integrated Approach:
Combining COII sequence data with morphological characteristics provides the most accurate identification. This integrated approach has been effective for resolving the Choristoneura fumiferana species complex .
Phylogenetic Analysis:
Construction of phylogenetic trees using Maximum Likelihood or Bayesian methods can place unknown samples within the established evolutionary framework of Choristoneura species .
Expressing mitochondrial proteins like COII in heterologous systems presents several challenges:
Codon Usage Bias:
Mitochondrial genomes use a different genetic code from nuclear genomes
Solution: Codon optimization of the COII gene for the chosen expression system
Membrane Protein Folding:
COII is normally embedded in the inner mitochondrial membrane
Solutions:
Use of specialized expression strains (C41/C43)
Expression as fusion proteins with solubility-enhancing tags
Addition of detergents or lipids during purification
Post-Translational Modifications:
Native modifications may be absent in heterologous systems
Solution: Choose eukaryotic expression systems when modifications are critical
Protein Toxicity:
Overexpression may be toxic to host cells
Solutions:
Tight regulation of expression using inducible promoters
Lower induction temperatures (16-20°C)
Cell-free expression systems
Protein Verification:
Confirming proper folding and function is challenging
Solutions:
Spectroscopic analysis
Activity assays comparing recombinant and native proteins
COII sequence variation in Choristoneura correlates with ecological adaptations in several ways:
Host Plant Specialization:
The diversification of Choristoneura species shows a pattern related to herbivorous specialization, with distinct clades specialized for feeding on conifers (like C. biennis) versus polyphagous species . COII sequences often reflect these ecological divergences.
Geographic Distribution:
Sequence variation in mitochondrial genes correlates with the biogeographic distribution of Choristoneura species across Nearctic and Palearctic regions .
Thermal Adaptation:
Sequence variations in mitochondrial genes like COII may reflect adaptations to different thermal environments, particularly relevant for species like C. biennis and C. fumiferana that must survive harsh winter conditions .
Divergence Timing:
Molecular clock analyses using mitochondrial genes suggest that major diversification events in Choristoneura occurred around 16 million years ago , potentially coinciding with climatic changes affecting host plant distributions.
COII plays a crucial role in elucidating the evolutionary history of Choristoneura:
Phylogenetic Reconstruction:
COII sequences provide data for reconstructing evolutionary relationships within Choristoneura, helping resolve the position of C. biennis relative to other species .
Divergence Time Estimation:
As a mitochondrial gene with a relatively stable evolutionary rate, COII can be used in molecular clock analyses to estimate divergence times between species lineages .
Historical Biogeography:
COII data contribute to biogeographical analyses, supporting hypotheses about the Holarctic origin of Choristoneura approximately 23 million years ago and subsequent colonization events .
Species Delimitation:
COII sequence data, integrated with morphological characteristics, helps identify cryptic species within species complexes, providing insights into speciation processes within the genus .
Evolutionary Rate Heterogeneity:
Analyzing variation in evolutionary rates of COII across different Choristoneura lineages can identify branches under different selective pressures, potentially correlating with ecological shifts.
Recommended Protocol for mtDNA Extraction from C. biennis:
Specimen Preparation:
Use fresh or properly preserved specimens (≤95% ethanol, -80°C storage)
For adult moths, remove wings and use thoracic muscle tissue
For larvae, use whole specimens or body sections avoiding gut contents
Tissue Homogenization:
Homogenize in buffer containing 10 mM Tris-HCl (pH 8.0), 150 mM NaCl, 10 mM EDTA, and 1% SDS
Add proteinase K (final concentration 100 μg/ml)
Incubate at 55°C for 3-4 hours with gentle agitation
DNA Extraction Methods:
Commercial kits: Qiagen DNeasy Blood & Tissue Kit with modifications for small specimens
CTAB method: Particularly effective for museum specimens or degraded samples
For difficult samples, phenol-chloroform extraction may yield better results
Quality Control:
Assess DNA quality using spectrophotometry (A260/A280 ratio)
Verify mtDNA enrichment by PCR amplification of mitochondrial and nuclear markers
Evaluate DNA integrity by gel electrophoresis
Storage:
Store extracted DNA at -20°C for short-term or -80°C for long-term preservation
Avoid repeated freeze-thaw cycles by creating working aliquots
While specific primers for C. biennis COII are not detailed in the search results, the following primer sets have been effective for COII amplification in Lepidoptera and specifically in Tortricidae:
Universal Lepidoptera COII Primers:
| Primer Name | Sequence (5' to 3') | Position | Direction |
|---|---|---|---|
| COII-F | ATGGCAGATTAGTGCAATGG | 5' end | Forward |
| COII-R | GTTTAAGAGACCAGTACTTG | 3' end | Reverse |
| COII-Tort-F | ATAGAKCWTCWCCWATWGCATTYCC | Internal | Forward |
| COII-Tort-R | GTTAARGATAWGGATCTAAWGTTCA | Internal | Reverse |
PCR Conditions:
Initial denaturation: 95°C for 5 minutes
35 cycles of:
Denaturation: 94°C for 30 seconds
Annealing: 50-52°C for 45 seconds
Extension: 72°C for 1 minute
Final extension: 72°C for 10 minutes
For Difficult Samples:
Use nested PCR approach with external primers followed by internal primers
Add 3% DMSO to reduce secondary structure formation
For museum specimens, design overlapping shorter amplicons (<300 bp)
For expression studies, design primers with appropriate restriction sites for cloning into expression vectors, accounting for the desired reading frame and fusion tags.
The choice of vector system depends on the expression host and research objectives:
For E. coli Expression:
| Vector Type | Representative Vector | Features | Best For |
|---|---|---|---|
| T7 Expression | pET-28a, pET-SUMO | IPTG-inducible, high expression | Basic expression studies |
| Cold-shock | pCold-I | Induction at low temperatures (15°C) | Improving solubility |
| Dual fusion | pET-Duet | Co-expression of multiple proteins | Complex formation studies |
| Low-copy | pACYC-Duet | Reduced expression level | Toxic proteins |
For Insect Cell Expression:
Baculovirus vectors (e.g., pFastBac™)
Features: Polyhedrin promoter, high-level expression, post-translational modifications
Consider adding C-terminal His-tag for purification
For Yeast Expression:
pPICZ series for Pichia pastoris
Features: Methanol-inducible promoter, secretion signals, multiple copy integration
Key Considerations:
Include affinity tags (His, FLAG, GST) for purification
Add protease cleavage sites for tag removal
Optimize codon usage for the expression host
Consider fusion partners (SUMO, MBP, Trx) to enhance solubility
Include appropriate signal sequences for membrane protein targeting
Purifying recombinant COII requires strategies appropriate for membrane proteins:
Extraction and Solubilization:
Lyse cells using mechanical disruption (sonication or homogenization)
Isolate membrane fraction by differential centrifugation
Solubilize membranes using detergents:
Mild detergents: n-Dodecyl β-D-maltoside (DDM), digitonin
Intermediate detergents: LDAO, OG
Test detergent screening panel to optimize
Affinity Chromatography:
Immobilized metal affinity chromatography (IMAC) for His-tagged COII
Anti-FLAG affinity for FLAG-tagged constructs
GST-affinity chromatography for GST fusion proteins
Additional Purification Steps:
Size exclusion chromatography to remove aggregates
Ion exchange chromatography for further purification
Affinity tag removal using specific proteases (TEV, thrombin)
Quality Assessment:
SDS-PAGE and Western blotting to verify purity and identity
Mass spectrometry for accurate molecular weight determination
Circular dichroism to assess secondary structure
Functional assays to confirm activity
Storage Conditions:
Store in buffers containing appropriate detergent at concentrations above CMC
Add glycerol (10-20%) for stability
Store at -80°C in small aliquots to avoid freeze-thaw cycles
Verifying structural integrity of recombinant COII requires multiple approaches:
Spectroscopic Methods:
Circular Dichroism (CD)
Far-UV CD (190-250 nm): Secondary structure content
Near-UV CD (250-350 nm): Tertiary structure fingerprint
Fluorescence Spectroscopy
Intrinsic tryptophan fluorescence for tertiary structure assessment
Changes in emission maximum indicate folding status
Fourier Transform Infrared Spectroscopy (FTIR)
Particularly useful for membrane proteins like COII
Provides information on secondary structure elements
Hydrodynamic Properties:
Size Exclusion Chromatography (SEC)
Monodisperse peak indicates properly folded protein
Multiple peaks suggest aggregation or degradation
Dynamic Light Scattering (DLS)
Measures particle size distribution
Monodisperse sample indicates uniform protein state
Functional Assays:
Enzymatic Activity
Cytochrome c oxidase activity using reduced cytochrome c as substrate
Polarographic measurement of oxygen consumption
Ligand Binding
Spectroscopic detection of heme and copper cofactor binding
Differential scanning fluorimetry for thermal stability assessment
Structural Analysis:
A comprehensive bioinformatic pipeline for COII analysis includes:
Quality Control and Sequence Processing:
Trim adapter sequences and low-quality bases (Trimmomatic or CutAdapt)
Perform quality assessment (FastQC)
Assemble paired-end reads if applicable (SPAdes or Velvet)
Sequence Alignment:
Multiple sequence alignment using MAFFT or MUSCLE with G-INS-i strategy
Manual inspection and refinement in AliView or Geneious
Removal of poorly aligned regions using Gblocks or TrimAl
Phylogenetic Analysis:
Model selection using ModelTest-NG or jModelTest
Tree reconstruction methods:
Maximum Likelihood: IQ-TREE or RAxML
Bayesian Inference: MrBayes or BEAST
Branch support assessment:
Bootstrap replicates (1000+) for ML trees
Posterior probabilities for Bayesian trees
Species Delimitation Analysis:
Distance-based methods: ABGD or PTP
Coalescent-based methods: GMYC or BPP
Integrative approaches combining multiple lines of evidence
Divergence Time Estimation:
Calibrate molecular clock using fossil evidence
BEAST2 or MCMCTree for time-calibrated phylogenies
FigTree or TimeTree for visualization
Sequence Polymorphism Analysis:
DnaSP for nucleotide diversity, haplotype diversity, and neutrality tests
MEGA or PAML for selection analysis (dN/dS ratios)
This pipeline has been successfully applied to analyze mitochondrial genes in Tortricidae and specifically in Choristoneura species .
When COII-based phylogenies conflict with nuclear gene trees in Choristoneura, researchers should:
Potential Causes of Conflict:
Incomplete Lineage Sorting (ILS):
Recent rapid speciation events may result in random sorting of ancestral polymorphisms
Test with coalescent-based methods (ASTRAL, *BEAST)
Introgression/Hybridization:
Mitochondrial capture through hybridization
Test using ABBA-BABA tests or similar methods
Selection Pressures:
Adaptive evolution in mitochondrial genes
Analyze using selection tests (PAML, HyPhy suite)
Sex-Biased Dispersal:
Maternally inherited mtDNA reflects female dispersal patterns
Compare geographic structure in mitochondrial vs. nuclear markers
Resolution Approaches:
Multi-locus Approaches:
Analyze multiple nuclear loci alongside mitochondrial data
Use species tree methods that account for gene tree discordance
Integrated Analysis:
Network-Based Methods:
Phylogenetic networks can visualize conflicting signals better than bifurcating trees
Methods: SplitsTree, PhyloNetworks
Simulation Studies:
Simulate data under different evolutionary scenarios
Compare simulated patterns with observed discordance
Discordance between mitochondrial and nuclear markers is common in Lepidoptera and has been documented in Choristoneura species, often reflecting complex evolutionary histories rather than methodological artifacts .
Determining species boundaries in closely related Choristoneura species requires multiple complementary approaches:
Distance-Based Methods:
Automatic Barcode Gap Discovery (ABGD)
Identifies barcode gaps in pairwise genetic distances
Parameters: Pmin=0.001, Pmax=0.1, Steps=10, X=1.5
Barcode Index Number (BIN)
Clusters sequences into operational taxonomic units
Particularly useful for initial sorting of specimens
Tree-Based Methods:
Poisson Tree Processes (PTP)
Models speciation in terms of substitution events
Infers species boundaries directly from phylogenetic trees
General Mixed Yule Coalescent (GMYC)
Identifies transition points between speciation and coalescent processes
Requires ultrametric trees (time-calibrated)
Coalescent-Based Methods:
Bayesian Phylogenetics & Phylogeography (BPP)
Multispecies coalescent model
Incorporates uncertainty in gene tree estimation
Requires prior assignment to populations
Integrated Approaches:
Iterative Taxonomic Validation
Cross-validate results from multiple methods
Identify consensus species hypotheses
Integrative Taxonomy
Combine COII data with:
Morphological characters
Ecological data (host plant associations)
Geographical distribution
Behavioral traits (pheromone composition)
This integrative approach has proven effective for species delimitation within the Choristoneura fumiferana cryptic species complex, where mitochondrial DNA and morphological data were combined to resolve taxonomic uncertainties .
COII sequence data provides valuable information for molecular dating in Choristoneura:
Calibration Points:
Fossil Calibrations
Tortricid fossils can provide minimum age constraints
Calibration should account for preservation biases
Secondary Calibrations
Molecular Clock Models:
Strict Clock
Assumes constant rate across all lineages
Rarely appropriate for Lepidoptera due to rate heterogeneity
Relaxed Clocks
Uncorrelated lognormal relaxed clock (UCLN) in BEAST2
Allows rates to vary among lineages
Better accommodates rate variation in Choristoneura
Dating Methods:
Bayesian Methods
BEAST2 with appropriate tree priors (Yule or Birth-Death)
MCMCTree in PAML package
Penalized Likelihood
r8s software for single gene trees
Useful for comparison with Bayesian estimates
Analytical Considerations:
Partition Schemes
Treat codon positions separately
Test different substitution models for each partition
Prior Settings
Use informative but not overly restrictive priors
Perform sensitivity analyses varying key parameters
COII-based divergence time estimation has contributed to understanding the biogeographic history of Choristoneura, supporting hypotheses about the timing of major diversification events and their correlation with host plant evolution .
Analyzing selection pressures on COII in Choristoneura lineages requires:
Site-Specific Selection Analyses:
Maximum Likelihood Methods
PAML (CodeML) site models:
M0 (one-ratio) vs. M3 (discrete)
M1a (nearly neutral) vs. M2a (positive selection)
M7 (beta) vs. M8 (beta+ω>1)
HyPhy suite methods:
SLAC (Single Likelihood Ancestor Counting)
FEL (Fixed Effects Likelihood)
MEME (Mixed Effects Model of Evolution) for episodic selection
Branch-Specific Selection Analyses:
Branch Models (PAML)
Two-ratio model: conifer-feeding vs. broad-leaf feeding lineages
Free-ratio model: separate ω for each branch
Branch-Site Methods
PAML branch-site test for positive selection
aBSREL (adaptive Branch-Site Random Effects Likelihood) in HyPhy
Codon Substitution Models:
Mechanistic Codon Models
MutSel models accounting for mutation bias and selection
Implemented in PhyloBayes-MPI
Structural Considerations:
Structure-Based Analyses
Map selected sites to structural models
COII structure prediction using AlphaFold2
Analysis of functional domains and sites
Population Genetics Approaches:
McDonald-Kreitman Test
Compares polymorphism within species to divergence between species
Implementation in DnaSP or PopGenome
Tajima's D and related statistics
Detect deviations from neutrality
Particularly informative when comparing different Choristoneura lineages
These methods can reveal how selection pressures on COII differ between conifer-feeding Choristoneura species (like C. biennis) and those that feed on other host plants, potentially correlating with adaptations to different ecological niches.
Future research on C. biennis COII should focus on:
Complete characterization of recombinant COII properties
Biochemical and biophysical studies of protein function
Comparison with COII from other Choristoneura species
Comparative genomics and transcriptomics
Integration of COII data with whole genome sequence data
Analysis of nuclear-mitochondrial gene co-evolution
Ecological adaptation studies
Correlation of COII sequence variation with adaptation to different host plants
Investigation of cold tolerance mechanisms in relation to mitochondrial function
Applied research applications
Development of molecular markers for pest monitoring
Exploration of species-specific targets for pest management
Integrative phylogenomics
Combination of COII with genome-wide data for comprehensive phylogeny
Resolution of species boundaries in taxonomically challenging Choristoneura groups
The integration of molecular, morphological, and ecological data will continue to enhance our understanding of Choristoneura biennis and its evolutionary relationships, contributing to both basic science and applied forest management.
COII studies can make significant contributions to conservation and forest management:
Species identification and monitoring
Molecular diagnostics for early detection of pest species
Tracking population dynamics and range expansions
Evolutionary potential assessment
Genetic diversity analysis to predict adaptation capacity
Identification of locally adapted populations
Climate change response prediction
Correlation of COII variants with thermal tolerance
Projection of range shifts under climate change scenarios
Integrated pest management
Species-specific control strategies based on molecular differences
Resistance monitoring in managed populations
Ecosystem impact assessment
Understanding the role of Choristoneura species in forest succession
Modeling interactions between pest outbreaks and forest dynamics