Recombinant Choristoneura fumiferana nuclear polyhedrosis virus Major envelope glycoprotein (GP67)

What is GP67 and what is its fundamental role in baculoviruses?

GP67 is a pH-dependent membrane fusion protein found exclusively in the budded virus phenotype of baculoviruses, including Choristoneura fumiferana multinucleocapsid nuclear polyhedrosis virus (CfMNPV). It plays a critical role in viral entry into host cells. The protein has been identified in multiple baculoviruses including Autographa californica MNPV (AcMNPV) and Orygia pseudotsugata MNPV (OpMNPV) .

Methodological approach for studying GP67 function:

• Viral infection assays with wild-type and GP67-deficient viruses

• pH-dependent membrane fusion assays

• Immunofluorescence microscopy to track GP67 during viral entry

• Site-directed mutagenesis to identify functional domains

How is the CfMNPV GP67 gene structurally related to other baculovirus GP67 genes?

The CfMNPV GP67 gene shows significant sequence homology to other baculovirus envelope proteins. Specifically, it is 79% identical to AcMNPV GP67 at the nucleotide sequence level and 82% identical at the predicted amino acid sequence level . This high conservation across different viral species indicates the evolutionary significance of GP67 in baculovirus biology.

The CfMNPV GP67 gene has been submitted to GenBank with the accession number L124120 .

What are the basic structural characteristics of the GP67 protein?

Based on characterization of AcMNPV GP67 (highly similar to CfMNPV GP67), the protein features:

• 529 amino acid residues with a molecular mass of approximately 60,167 daltons

• Two hydrophobic regions near the N and C termini

• Six potential N-linked glycosylation sites

• C-terminal region containing basic amino acids that likely play a role in virion assembly

The protein undergoes processing including signal peptide cleavage and becomes anchored at its C terminus in the virus envelope. The full open reading frame spans 1,590 nucleotides and is flanked by AT-rich sequences .

What is the expression pattern of the GP67 gene during viral infection?

The GP67 gene expression follows a specific temporal pattern during viral infection:

• Transcription produces a 2.1-kilobase transcript

• Expression is detected early in infection (approximately 2 hours post-infection)

• Transcript abundance peaks at around 18 hours post-infection

• Expression decreases thereafter but remains at detectable levels

Methodological approach for studying expression:

• Northern blot analysis to detect transcript size and abundance

• qRT-PCR for quantitative measurement of transcript levels

• Western blot analysis to monitor protein expression

• Immunofluorescence microscopy to visualize cellular localization

How can the GP67 signal peptide be utilized to enhance recombinant protein expression systems?

The GP67 signal peptide has emerged as a valuable tool for improving recombinant protein expression and secretion in baculovirus expression systems. Research shows that introducing the GP67 signal peptide preceding a target gene significantly improves expression yields compared to using the protein's intrinsic signal peptide .

Methodology for implementing this approach:

• Modification of baculovirus expression vector by introducing the GP67 signal sequence between the promoter and multiple-cloning sites

• Design primers to amplify the GP67 secretion signal sequence (e.g., TCTTTTTGCGGCCGCATGCTACTAGTAAATCAGTC) with appropriate restriction sites

• Clone the target gene without its native signal sequence into this modified vector

• Transform DH10Bac competent cells with the construct (100 ng) and select transformants

• Extract and verify bacmid DNA, then transfect insect cells

• Culture and purify the secreted recombinant protein from cell supernatant

This approach facilitates proper protein glycosylation, disulfide bond formation, and other post-translational modifications necessary for correct folding and stabilization of complex eukaryotic proteins .

What are the optimal methods for analyzing contradictions in experimental data regarding GP67 function?

Contradictory results in GP67 research often arise from variations in experimental conditions. Based on methodologies used in clinical contradiction detection:

• Systematic comparison framework:

  • Create paired statements from literature that represent potential contradictions

  • Categorize contradictions using parameters (α, β, θ) where α represents interdependent items, β represents contradictory dependencies, and θ represents minimal required Boolean rules

  • Apply distant supervision techniques to identify inconsistent claims

• Experimental variables analysis matrix:

  • Document all experimental conditions comprehensively

  • Create a matrix comparing cell types, viral strains, and methodological variations

  • Identify "intervention mismatch" scenarios where contradictory outcomes may result from differences in experimental design

• Statistical resolution approaches:

  • Apply appropriate statistical methods to determine if contradictions are statistically significant

  • Consider measurement uncertainty and experimental power

  • Implement meta-analysis when multiple datasets exist

Research shows that when analyzing contradictions, many apparent discrepancies (12 false positives in one study) were attributed to "mismatch in intervention or experimental design, despite contradictory outcomes" , highlighting the importance of standardized experimental conditions in GP67 functional studies.

How can researchers design optimal expression vectors with GP67 signal peptide for difficult-to-express proteins?

For challenging recombinant proteins, optimization of expression constructs with GP67 signal peptide requires several strategic considerations:

• Vector design optimization protocol:

  • Clone the GP67 signal sequence using PCR with primers containing appropriate restriction sites

  • Example forward primer: TCTTTTTGCGGCCGCATGCTACTAGTAAATCAGTC (incorporating NotI)

  • Create fusion constructs where the GP67 signal peptide is precisely joined to the mature protein sequence

  • Add C-terminal purification tags (e.g., 8x His tag) with primers such as: TCTAGACTCGAGTTA GTGATGATGATGGTGATGGTGATG

  • Optimize the translation initiation context and codon usage

• Experimental validation workflow:

  • Compare expression levels between native signal peptide and GP67 signal peptide constructs

  • Analyze secretion efficiency using Western blot analysis of cell lysate versus supernatant

  • Assess protein folding and activity through functional assays

  • Optimize expression conditions (temperature, time, MOI) for individual proteins

The GP67 signal peptide has been shown to mediate forced secretion of recombinant proteins even if they are not normally secreted, making it particularly valuable for difficult expression targets .

What approaches can resolve data contradictions in GP67-mediated membrane fusion studies?

GP67-mediated membrane fusion studies may yield conflicting results due to experimental variability. Effective approaches to resolve these contradictions include:

• Standardized experimental framework:

  • Establish consistent protocols for preparing virus samples

  • Control pH conditions precisely during fusion assays

  • Standardize membrane composition in liposome fusion studies

  • Develop quantitative metrics for fusion efficiency

• Multi-parameter analysis:

  • Simultaneously measure multiple fusion parameters (lipid mixing, content mixing, pore formation)

  • Correlate structural changes with functional outcomes

  • Implement time-resolved measurements to capture fusion kinetics

• Comparative analysis across viral species:

  • Directly compare GP67 from different baculoviruses (AcMNPV, OpMNPV, CfMNPV) under identical conditions

  • Create chimeric proteins to identify domains responsible for functional differences

  • Use site-directed mutagenesis to test specific hypotheses about functional residues

• Advanced structural techniques:

  • Apply cryo-electron microscopy to capture fusion intermediates

  • Utilize hydrogen-deuterium exchange mass spectrometry to identify conformational changes

  • Implement computational modeling to predict fusion mechanisms

This systematic approach helps distinguish genuine biological differences from technical artifacts in contradictory datasets.

How can researchers optimize purification strategies for recombinant GP67 protein?

Purification of recombinant GP67 presents challenges due to its glycosylation and hydrophobic domains. Effective purification strategies include:

• Affinity chromatography approach:

  • Design expression constructs with C-terminal His-tags (8x His recommended)

  • Implement immobilized metal affinity chromatography (IMAC) using Ni-NTA resins

  • Optimize imidazole concentration in buffers to reduce non-specific binding

  • Consider using anti-GP67 monoclonal antibodies for immunoaffinity purification

• Multi-step purification protocol:

  • Begin with clarification of culture supernatant through centrifugation and filtration

  • Perform initial capture using affinity chromatography

  • Implement ion exchange chromatography as an intermediate purification step

  • Use size exclusion chromatography for final polishing and buffer exchange

• Glycoprotein-specific considerations:

  • Add detergents to maintain solubility of hydrophobic domains

  • Optimize buffer conditions to preserve glycosylation

  • Consider enzymatic deglycosylation if glycans interfere with downstream applications

  • Implement lectin affinity chromatography as an alternative purification approach

• Quality control metrics:

  • SDS-PAGE and Western blotting to confirm identity and purity

  • Mass spectrometry to verify intact mass and glycosylation patterns

  • Functional assays to confirm biological activity of purified protein

What are the recommended protocols for cloning and expressing recombinant CfMNPV GP67?

A comprehensive methodology for cloning and expressing recombinant CfMNPV GP67 involves:

• Gene amplification and vector construction:

  • Design primers to amplify the GP67 coding sequence from CfMNPV genomic DNA

  • Incorporate appropriate restriction sites (e.g., NotI, XhoI) for directional cloning

  • Clone into a baculovirus transfer vector with a polyhedrin or p10 promoter

  • Add a C-terminal His-tag sequence for purification

  • Verify construct by sequencing

• Recombinant baculovirus generation protocol:

  • Transform DH10Bac competent cells with 100 ng of construct plasmid

  • Incubate transformation plates at 37°C for 48 hours

  • Select white colonies and culture in LB medium with appropriate antibiotics

  • Extract bacmid DNA following the baculovirus expression system protocol

  • Transfect insect cells (Sf9 or High Five) with verified bacmid DNA

• Protein expression optimization:

  • Determine optimal multiplicity of infection (MOI) through pilot experiments

  • Monitor protein expression kinetics over 24-96 hours post-infection

  • Optimize harvest time based on expression peak (typically 72 hours)

  • Analyze expression by Western blot using anti-His or anti-GP67 antibodies

• Purification strategy:

  • Collect culture supernatant containing secreted GP67

  • Perform affinity chromatography using Ni-NTA or similar matrix

  • Implement additional purification steps as needed

  • Confirm protein identity by mass spectrometry and functional assays

What methods are most effective for analyzing post-translational modifications of GP67?

GP67 contains multiple post-translational modifications, particularly N-linked glycosylation. Effective analysis methods include:

• Glycosylation site mapping protocol:

  • Protease digestion (trypsin, chymotrypsin) to generate peptide fragments

  • Enrichment of glycopeptides using lectin affinity or hydrophilic interaction chromatography

  • LC-MS/MS analysis with electron transfer dissociation (ETD) for site localization

  • Software analysis using tools like Byonic or PEAKS for glycopeptide identification

• Glycan composition analysis:

  • Release of N-glycans using PNGase F treatment

  • Fluorescent labeling of released glycans

  • Separation by HILIC-UPLC or capillary electrophoresis

  • MS analysis of released glycans for composition determination

• Site-directed mutagenesis approach:

  • Systematically mutate predicted N-glycosylation sites (Asn-X-Ser/Thr)

  • Express wild-type and mutant proteins

  • Compare molecular weight shifts by SDS-PAGE

  • Assess impact on protein function and trafficking

• MALDI-TOF mass spectrometry protocol:

  • Prepare samples using established protocols for glycoprotein analysis

  • Apply direct MALDI-TOF MS identification method as described in result

  • Compare glycoforms based on mass differences

  • Implement database searching for glycan structure identification

How can researchers evaluate the functional activity of recombinant GP67 in membrane fusion assays?

To assess GP67-mediated membrane fusion activity:

• Cell-cell fusion assay protocol:

  • Express recombinant GP67 in insect cells

  • Label cell populations with different fluorescent markers

  • Induce fusion by lowering pH to ~5.0-5.5

  • Quantify fusion events by fluorescence microscopy or flow cytometry

  • Calculate fusion index (nuclei in syncytia/total nuclei × 100%)

• Liposome fusion assay methodology:

  • Purify recombinant GP67 with intact fusion functionality

  • Prepare liposomes containing fluorescent lipid probes (e.g., NBD-PE and Rh-PE)

  • Incorporate purified GP67 into labeled liposomes

  • Mix with unlabeled target liposomes

  • Trigger fusion by pH reduction and monitor fluorescence dequenching

• Pseudotyped virus infection assay:

  • Generate baculovirus particles displaying recombinant GP67

  • Label viral and/or cellular membranes with lipophilic dyes

  • Monitor membrane mixing during virus-cell fusion by fluorescence microscopy

  • Quantify fusion kinetics through image analysis

• Biophysical characterization of fusion intermediates:

  • Monitor conformational changes of GP67 at different pH values using circular dichroism

  • Use tryptophan fluorescence to track exposure of hydrophobic domains

  • Apply limited proteolysis to identify protease-sensitive regions that emerge during the fusion process

  • Implement negative stain electron microscopy to visualize fusion intermediates

What are the current methods for studying the interaction between GP67 and viral or host components?

Understanding GP67 interactions with other viral and cellular components requires sophisticated methodologies:

• Co-immunoprecipitation protocol:

  • Generate lysates from virus-infected cells

  • Use anti-GP67 antibodies for immunoprecipitation

  • Analyze co-precipitated proteins by mass spectrometry

  • Confirm specific interactions through reverse co-immunoprecipitation

• Proximity labeling methodology:

  • Create fusion proteins of GP67 with BioID or APEX2 enzymes

  • Express in insect cells and activate labeling

  • Purify biotinylated proteins using streptavidin

  • Identify proximal proteins by mass spectrometry

• Surface plasmon resonance (SPR) analysis:

  • Immobilize purified GP67 on a sensor chip

  • Flow potential interaction partners over the surface

  • Measure binding kinetics (kon and koff rates)

  • Determine equilibrium dissociation constants (KD)

• Cryo-electron microscopy approach:

  • Purify GP67-containing viral particles or reconstituted complexes

  • Prepare samples for cryo-EM analysis

  • Collect and process image data

  • Generate 3D reconstructions to visualize interaction interfaces

This multi-faceted approach provides comprehensive insights into the molecular interactions governing GP67 function in the viral life cycle.

Human subjects research note: The use of GP67 in research does not typically involve human subjects, as work is conducted in insect cell culture systems. However, any research involving clinical samples or human subjects would require appropriate ethical approvals in accordance with the declaration of Helsinki .