Recombinant Danio rerio CTP synthase 1 (ctps), partial

What is CTP synthase 1 in Danio rerio and how does it function in nucleotide metabolism?

CTP synthase (CTPS) is a critical metabolic enzyme that catalyzes the rate-limiting step in de novo CTP synthesis, which is essential for nucleotide, phospholipid, and sialoglycoprotein production. In zebrafish (Danio rerio), there are two CTPS genes: ctps1a and ctps1b . The enzymatic reaction catalyzed by CTPS is:

ATP + UTP + glutamine → ADP + Pi + CTP + glutamate

The reaction proceeds through ATP-dependent phosphorylation of UTP on the 4-oxygen atom, making the 4-carbon electrophilic and vulnerable to nucleophilic attack by ammonia. Glutamine serves as the nitrogen donor, being hydrolyzed in a glutamine amidotransferase domain to produce ammonia, which is then channeled through the enzyme's interior to the synthetase domain where it reacts with the 4-phosphoryl UTP intermediate .

How do zebrafish CTP synthase 1 genes differ from human CTPS genes structurally and functionally?

Phylogenetic analyses indicate that zebrafish ctps1a and ctps1b diverged from homologues in the ancestral Actinopterygii, specifically Oreochromis niloticus. Conservation of common CTPS-catalytic regions establishes that both proteins are likely functionally similar to human CTPS (hsaCTPS) .

Humans have two isoforms: CTPS1 and CTPS2, which share 75% sequence identity but have distinct physiological roles. While CTPS2 is uniformly expressed across various tissues, CTPS1 expression is generally low but is upregulated in activated T cells . In contrast, zebrafish ctps1a appears more critical throughout early embryonic development than ctps1b, suggesting a functional specialization between these paralogs .

What expression systems are most suitable for producing recombinant Danio rerio CTP synthase 1?

Based on the available research, several expression systems can be considered for producing recombinant zebrafish CTP synthase:

• Yeast expression system: The yeast expression system has been successfully used for human CTPS1, where the intact gene sequence is expressed and the resulting protein is fused with a 6xHis-tag for purification . This system allows for post-translational modifications that may be important for function, such as phosphorylation.

• Insect cell expression: S2 Drosophila cell lines have been used for recombinant protein expression of other proteins from zebrafish, suggesting they could be appropriate for ctps expression .

• Mammalian expression: Chinese hamster ovary (CHO) cell lines have also been employed for recombinant zebrafish protein production .

The choice of expression system should consider factors such as post-translational modifications, protein folding requirements, and the intended application of the recombinant protein.

What purification strategies yield the highest activity for recombinant zebrafish CTP synthase?

For optimal purification of active recombinant zebrafish CTP synthase, consider the following methodological approach:

• Affinity chromatography: Using a His-tag fusion, affinity purification under mild conditions is effective. The cusabio protocol for human CTPS1 employs affinity chromatography that preserves enzymatic activity .

• Purification conditions: Mild purification conditions are critical to maintain the quaternary structure and activity of CTP synthase, as active CTP synthase exists as a homotetrameric enzyme. At low enzyme concentrations and in the absence of ATP and UTP, CTP synthase exists as an inactive monomer .

• Buffer optimization: Include ATP and UTP in purification buffers to promote tetramerization, as these substrates are required for the formation of the active tetrameric form .

• Quality assessment: Evaluate purity using SDS-PAGE (expecting a band of approximately 70 kDa) and confirm activity through enzymatic assays measuring the conversion of UTP to CTP .

How can the enzymatic activity of recombinant zebrafish CTP synthase be reliably measured?

To measure the enzymatic activity of recombinant zebrafish CTP synthase, researchers can employ the following methodological approach:

• EnzChek pyrophosphate assay: This assay can be used as described in the literature for measuring Sia activation. The reaction is performed in 50 mM Tris-HCl, pH 7.5, 25 mM MgCl₂, and initiated by adding the enzyme. CTP, UTP, ATP, or GTP can be used at a final concentration of 1000 μM, with Neu5Ac, Neu5Gc, or KDN at 4000 μM .

• Spectrophotometric assays: These monitor the formation of CTP from UTP and can be conducted by measuring absorbance changes at appropriate wavelengths.

• In vivo activity assay: Functionality can be analyzed in complementation studies using cell lines deficient in CTPS activity. For example, in studies with human CTPS, CHO LEC29.Lec32 cells have been used. Transfected cells are harvested, and protein expression is analyzed by Western blotting .

What factors affect the regulation of zebrafish CTP synthase activity and how can they be experimentally manipulated?

CTP synthase activity is regulated by several factors that can be experimentally manipulated:

• Substrate availability: ATP, UTP, and glutamine concentrations affect enzyme activity. These can be varied in experimental assays to determine kinetic parameters.

• Feedback inhibition: CTP feedback inhibition is a key regulatory mechanism. Human CTPS1 has reduced sensitivity to CTP feedback inhibition compared to CTPS2, contributing to its role in expanding CTP pools in proliferating cells . Experimental approaches to study this include:

  • Varying CTP concentrations in activity assays

  • Using site-directed mutagenesis to alter CTP binding sites

  • Structural studies to understand the mechanism of inhibition

• Tetramerization: The active form of CTP synthase is a tetramer. ATP and UTP promote tetramerization . Experimental approaches include:

  • Adjusting enzyme concentration and substrate availability

  • Size-exclusion chromatography to determine oligomeric state

  • Cryo-EM or other structural techniques to visualize the tetrameric form

• Inhibitors: DON (6-diazo-5-oxo-L-norleucine), a glutamine-analogue drug and CTPS antagonist, has been used in zebrafish studies and produces similar phenotypes to morpholino knockdown . Other selective inhibitors like R80 have been characterized for human CTPS1 .

What are the specific developmental consequences of CTP synthase 1 knockdown in zebrafish embryos?

CTP synthase knockdown during zebrafish early development results in several specific phenotypic consequences:

These findings can be experimentally validated using DON treatment, which produces similar phenotypes, strengthening the validity of the morpholino-induced observations .

How do ctps1a and ctps1b contribute differently to zebrafish development, and what experimental approaches can differentiate their roles?

Research indicates that ctps1a and ctps1b contribute differently to zebrafish development, with ctps1a being more critical throughout the initial period of embryonic development than ctps1b . To investigate and differentiate their specific roles, researchers can employ these methodological approaches:

• Gene-specific morpholinos: Design morpholinos targeting each gene individually and in combination with varying concentrations to observe dosage-dependent effects .

• In situ hybridization: Whole-mount in situ hybridization using gene-specific RNA probes can determine the spatial and temporal expression patterns of each gene during development. Specific probes can be generated by amplifying the 3' regions of ctps1a and ctps1b by RT-PCR with specific primers and cloning into vectors like pCR-Blunt II-TOPO .

• CRISPR/Cas9 gene editing: Generate gene-specific knockouts to observe long-term developmental consequences without potential off-target effects of morpholinos.

• Rescue experiments: Perform rescue experiments by co-injecting morpholinos with mRNA for each gene to confirm specificity and functional roles.

• PCR analysis: Use nested PCR protocols with gene-specific primers to analyze expression levels. For example:

  • Round 1 PCR: Initial denaturation at 94°C for 15 minutes; 30 cycles of 94°C/30 seconds, 55°C/30 seconds, 72°C/30 seconds; and final extension at 72°C for 5 minutes.

  • Round 2 nested PCR: Similar protocol with different primers and annealing temperature .

How can the structure-function relationship of zebrafish CTP synthase be investigated using advanced techniques?

Investigating the structure-function relationship of zebrafish CTP synthase can be approached through several advanced techniques:

• Cryo-electron microscopy (cryo-EM): This technique has been successfully used to determine the structure of human CTPS1 at 6.2-Å resolution, revealing details about CTP binding and tetramer conformation . For zebrafish CTP synthase, researchers could:

  • Use non-polymerizing mutations (similar to H355A in human CTPS1) to reduce nonspecific aggregation

  • Analyze both free tetramers and filamentous forms

  • Compare structures with different bound substrates or inhibitors

• X-ray crystallography: While challenging due to the dynamic nature of CTP synthase, crystallography could provide high-resolution structural insights.

• Site-directed mutagenesis: Targeted mutations in conserved catalytic residues or at the tetramer interface can help elucidate structure-function relationships. The effect of mutations can be assessed by:

  • In vitro activity assays

  • Oligomerization analysis

  • Complementation studies in cell culture systems

• Hydrogen-deuterium exchange mass spectrometry (HDX-MS): This can provide information about protein dynamics and conformational changes upon substrate binding or during catalysis.

• Computational modeling: Homology modeling based on human CTPS structures could predict structural features of zebrafish CTP synthase, guiding experimental design.

What are the molecular mechanisms underlying CTP synthase filament formation in zebrafish, and how can they be experimentally investigated?

CTP synthase can form filamentous structures, and investigating this phenomenon in zebrafish requires specific methodological approaches:

• Fluorescence microscopy: Express fluorescently tagged CTP synthase in zebrafish cells or embryos to visualize filament formation under different conditions.

• Electron microscopy: Use negative staining or cryo-EM to visualize filament structure at high resolution.

• Mutagenesis studies: Identify residues involved in filament formation by introducing mutations at potential interfaces. The active-state CTPS1 filament structure bound to UTP, glutamine, and AMPPNP (a non-hydrolyzable ATP analog) has been solved at 2.8-Å resolution, providing a framework for such studies .

• Biochemical assays: Assess the relationship between filament formation and enzymatic activity by comparing activity in conditions that promote or inhibit filament formation.

• In vivo studies: Investigate the physiological relevance of filament formation in zebrafish development using mutants that affect filament formation but not enzymatic activity.

How can zebrafish CTP synthase research inform our understanding of human immunological disorders associated with CTPS1 deficiency?

Zebrafish CTP synthase research can provide valuable insights into human immunological disorders associated with CTPS1 deficiency through several methodological approaches:

• Comparative functional studies: Human CTPS1 deficiency leads to severe immunodeficiency due to T cells failing to proliferate upon activation . Researchers can:

  • Compare the biochemical properties of zebrafish and human CTP synthases

  • Investigate whether zebrafish ctps1a or ctps1b is the functional ortholog of human CTPS1

  • Examine if differences in feedback inhibition by CTP observed in human CTPS1 vs. CTPS2 are conserved in zebrafish paralogs

• Transgenic rescue models: Generate zebrafish models with human CTPS1 mutations and attempt rescue with wild-type or mutant forms of zebrafish CTP synthase genes.

• T-cell proliferation assays: Examine whether T-cell proliferation in zebrafish requires CTP synthase activity similar to humans, and whether exogenous CTP can rescue proliferation defects in CTP synthase-deficient zebrafish T cells as it does in humans .

• Drug screening: Utilize zebrafish embryos to screen for compounds that modulate CTP synthase activity, potentially identifying therapeutic candidates for CTPS1 deficiency disorders.

What insights can zebrafish CTP synthase studies provide for developing selective inhibitors for therapeutic applications?

Zebrafish CTP synthase studies can contribute to the development of selective inhibitors for therapeutic applications through these methodological approaches:

• Comparative inhibitor studies: Test known inhibitors of human CTPS1, such as R80 (which selectively inhibits CTPS1 over CTPS2) , on zebrafish CTP synthase to determine conservation of inhibitory mechanisms.

• Structure-based drug design: Use structural information from zebrafish CTP synthase to design selective inhibitors that target species-specific or isoform-specific regions.

• In vivo efficacy testing: Zebrafish embryos can serve as a rapid in vivo model to assess the efficacy and toxicity of potential CTP synthase inhibitors. For example, DON treatment in zebrafish produces phenotypes similar to morpholino knockdown .

• Target validation: Studies showing that CTPS1 is critical for T cell proliferation but otherwise nonessential (with CTPS2 maintaining CTP levels in other tissues) make it an ideal target for immunosuppression . Zebrafish models can help validate this target separation concept across vertebrates.

• Phenotypic rescue experiments: Test whether selective inhibitors of one CTP synthase isoform produce phenotypes that can be rescued by the other isoform, helping to understand the therapeutic window and potential side effects.

What PCR protocols are optimal for amplifying and analyzing zebrafish CTP synthase genes?

For optimal amplification and analysis of zebrafish CTP synthase genes, researchers can employ the following PCR methodology:

Nested PCR Protocol for CTP Synthase Genes:

Round 1 PCR:

• Sample preparation: 25-μL reaction containing 1x HotStarTaq buffer, 1.5 mM MgCl₂, 0.2 mM dNTP mix, CTP synthase primers at 0.4 µM final concentration each (Forward: 5' ATTGCAAGTTCTGAGAATA; Reverse: 5' CAAACATTACGAGCAAATTC), 2.5 units of HotStarTaq polymerase, 5% DMSO, 100 ng of template DNA

• Thermal cycling conditions: Initial denaturation at 94°C for 15 minutes; 30 cycles of 94°C/30 seconds, 55°C/30 seconds, 72°C/30 seconds; and final extension at 72°C for 5 minutes

• Product dilution: Dilute PCR products 1:100 in molecular-grade water prior to use in round 2

Round 2 Nested PCR:

• Sample preparation: 50-μL reaction containing 1x HotStarTaq buffer, 2.5 mM MgCl₂, 0.2 mM dNTP mix, nested primers each at 0.4 µM (Forward: 5' GATATGGAAAATATTTTATTTATTG; Reverse: 5' AAACCAAGACAAATTCCAAG), 1.5 units of HotStarTaq polymerase, 1% formamide, 5 µL of diluted template DNA

• Thermal cycling conditions: Initial denaturation at 94°C for 15 minutes; 35 cycles of 94°C/30 seconds, 50°C/30 seconds, 72°C/30 seconds; and final extension at 72°C for 5 minutes

• Analysis: Analyze PCR products by standard agarose gel electrophoresis in a 1% gel referenced against a DNA marker

What approaches can be used to investigate the role of CTP synthase in zebrafish antiviral responses?

The role of CTP synthase in antiviral responses can be investigated in zebrafish using several methodological approaches:

• Viral infection models: Establish zebrafish models of viral infections similar to those affected by CMPK2/viperin-mediated restriction in mammals. CMPK2 uses CTP (produced by CTP synthase) as a substrate for viperin to synthesize ddhCTP, which acts as a chain terminator for viral RNA-dependent RNA polymerases .

• Gene knockdown/knockout studies: Use morpholinos or CRISPR/Cas9 to reduce ctps1a and ctps1b expression, then challenge zebrafish with viruses to assess the impact on viral replication.

• Expression analysis during viral infection: Monitor ctps gene expression changes during viral infection using qRT-PCR or in situ hybridization to determine if zebrafish upregulate CTP synthase in response to viral challenge.

• Pathway analysis: Investigate the relationship between zebrafish CTP synthase, the interferon response, and viperin-like antiviral factors. In humans, CMPK2 kinase activity provides CTP for viperin, which then synthesizes ddhCTP during the interferon response .

• Pharmacological intervention: Test CTP synthase inhibitors like DON on virus-infected zebrafish to determine if reducing CTP availability affects viral replication.

• Virus spectrum analysis: Examine whether CTP synthase in zebrafish affects a similar spectrum of viruses as in mammals, such as flaviviruses (DENV-2, ZIKV, KUNV, YFV17D), but not other RNA viruses like influenza A virus (IAV) or SARS-CoV-2 .