Recombinant Danio rerio Endoplasmic reticulum-Golgi intermediate compartment protein 3 (ergic3)

What is ERGIC3 and why is it significant in zebrafish research?

ERGIC3 (Endoplasmic reticulum-Golgi intermediate compartment protein 3) is a protein involved in trafficking between the endoplasmic reticulum and Golgi apparatus. The significance of studying ERGIC3 in zebrafish (Danio rerio) stems from several factors. First, zebrafish share approximately 70% of their genes with humans, including more than 84% of genes associated with human genetic diseases . Second, ERGIC3 plays critical roles in ER-Golgi trafficking, which is elevated in cancer cells, making it a potential target for cancer therapeutics . The zebrafish model provides unique advantages for studying ERGIC3 function, including transparent embryos allowing for direct visualization of developmental processes, rapid maturation (major organs form within 24 hours), and high reproductive capacity (producing up to 300 embryos every 2-3 days) .

How does ERGIC3 function in the ER-Golgi trafficking pathway?

ERGIC3 functions as a critical component in the membrane trafficking between the endoplasmic reticulum (ER) and Golgi apparatus. The endoplasmic reticulum-Golgi intermediate compartment (ERGIC) serves as a dynamic and mobile early secretory pathway located between these two organelles in cells . ERGIC3 participates in:

• Vesicle formation and budding from the ER

• Transport of cargo proteins between the ER and Golgi

• Maintenance of ER-Golgi structural integrity

• Regulation of protein sorting and quality control

Research has demonstrated that ERGIC also plays a significant role in autophagosome formation, particularly under starvation conditions. The ERGIC acts by recruiting the early autophagosome marker ATG14, which is a critical step for the generation of preautophagosomal membranes . This connection between ERGIC3, membrane trafficking, and autophagy highlights its importance in cellular homeostasis and stress response mechanisms.

What are the optimal expression systems for producing recombinant Danio rerio ERGIC3?

Several expression systems can be used for producing recombinant Danio rerio ERGIC3, each with specific advantages depending on research objectives:

For functional studies requiring proper folding and post-translational modifications, mammalian or baculovirus expression systems are recommended . When producing recombinant ERGIC3, incorporating appropriate tags (e.g., His-tag, Avi-tag) can facilitate purification and downstream applications. For instance, biotinylation using AviTag-BirA technology can be valuable for protein interaction studies, as the method catalyzes amide linkage between biotin and the specific lysine of the AviTag .

What techniques are most effective for ERGIC3 knockdown in zebrafish models?

For effective ERGIC3 knockdown in zebrafish models, several techniques have demonstrated efficacy:

• siRNA Transfection: Using Lipofectamine 3000 or similar transfection reagents with ERGIC3-specific siRNA has shown success in cell culture models. The transfection efficiency can be optimized with a 70-80% cell confluence prior to transfection .

• shRNA Delivery: Non-invasive aerosol delivery of shERGIC3 using biocompatible carriers such as glycerol propoxylate triacrylate and spermine (GPT-SPE) has been effective in in vivo lung cancer models .

• Morpholino Oligonucleotides: For zebrafish embryos, morpholino antisense oligonucleotides designed to block ERGIC3 translation or splicing can be microinjected at the 1-4 cell stage.

• CRISPR/Cas9 Gene Editing: For stable genetic modifications, CRISPR/Cas9-mediated knockout of ERGIC3 provides a more permanent approach.

When designing knockdown experiments, proper controls are essential, including negative control siRNAs and validation of knockdown efficiency through qRT-PCR. For example, primers for ERGIC3 amplification should be specific: forward: 5′GGAGAGGTACTGAGGACAAATCA3′, reverse: 5′AGCTCATAGAGGACGAAGACTC3′ .

How can researchers effectively analyze differential protein expression after ERGIC3 manipulation?

To effectively analyze differential protein expression following ERGIC3 manipulation, researchers should implement a comprehensive workflow:

• Sample Collection and Preparation:

  • Collect cells 72 hours post-transfection for optimal knockdown effect

  • Extract proteins using appropriate lysis buffers considering both intracellular and extracellular fractions

  • Use RNAiso Plus lysate for RNA extraction if planning transcriptomic analysis

• Quantitative Proteomics:

  • Apply isobaric tags for relative and absolute quantitation (iTRAQ)

  • Utilize liquid chromatography-tandem mass spectrometry (LC-MS/MS) for protein identification

  • Calculate protein expression using fragments per kilobase per million mapped fragments (FPKM)

• Bioinformatics Analysis:

  • Screen differentially expressed genes using DEseq2 (Fold Change ≥ 2.00 and Adjusted P value ≤0.05)

  • Apply PossionDis (Fold Change ≥ 2.00 and FDR ≤ 0.001)

  • Create visualization tools such as scatter plots and hierarchical clustering using R packages like pheatmap

• Protein Interaction Analysis:

  • Map differentially expressed proteins to the STRING database

  • Visualize protein-protein interaction (PPI) networks using Cytoscape 3.8.0

  • Analyze network topology using the Analyze Network plugin

  • Screen for functional modules with the MCODE plugin using parameters: degree cutoff = 2, node score cutoff = 0.2, k-score = 2, max.depth = 100

This methodology has been successfully applied in studies examining the effects of ERGIC3 knockdown in cancer cells, revealing significant changes in both intracellular and extracellular proteomes that provide insights into ERGIC3 function .

How does ERGIC3 contribute to autophagy regulation in zebrafish models?

ERGIC3 plays a crucial role in autophagy regulation through its function in the ERGIC compartment. Research has demonstrated that the ERGIC serves as a key membrane source for autophagosome formation. The mechanism involves:

• ERGIC acting as a primary membrane source both necessary and sufficient to trigger LC3 lipidation in vitro

• Recruitment of the early autophagosome marker ATG14 to the ERGIC membrane

• Generation of preautophagosomal structures essential for autophagosome biogenesis

In vitro assays have shown that LC3 lipidation, a critical step in autophagosome formation, requires energy and is regulated by pathways that modulate autophagy in vivo. The ERGIC's role has been confirmed through systematic membrane isolation schemes identifying it as essential for this process .

Knockdown of ERGIC3 in lung cancer cells leads to ER stress-induced autophagic cell death, suggesting that ERGIC3 functions as a negative regulator of stress-induced autophagy . This connection provides a potential mechanism through which ERGIC3 manipulation affects cell proliferation and survival, particularly in cancer cells where ER-Golgi trafficking is elevated.

What is the relationship between ERGIC3 and cancer in research models?

The relationship between ERGIC3 and cancer has been extensively studied, revealing several key mechanisms:

• Overexpression in Cancer Tissues: ERGIC3 is overexpressed in various cancers, including lung cancer, colorectal tumors, and hepatocellular carcinomas .

• Cell Proliferation and Survival: ERGIC3 promotes cell growth and significantly reduces ER stress-mediated cell death. Knockdown of ERGIC3 leads to suppression of proliferation in cancer cell lines such as A549 human lung cancer cells .

• Metastasis and EMT: ERGIC3 correlates with cell proliferation, migration, and epithelial-to-mesenchymal transition (EMT) in hepatocellular carcinomas .

• ER Stress Response: Knockdown of ERGIC3 induces ER stress-mediated autophagic cell death, suggesting a protective role against ER stress in cancer cells .

• Altered Protein Expression: After ERGIC3 knockdown in lung cancer cells, significant changes occur in both intracellular and extracellular proteomes:

  • 88 extracellular differentially expressed proteins (41 up-regulated, 47 down-regulated)

  • 52 intracellular differentially expressed proteins (33 up-regulated, 19 down-regulated)

Functional analysis of these differential proteins revealed involvement in Ca²⁺ binding and transport, and I-kappa B kinase/NF-kappa B signal transduction pathways . These findings suggest that targeting ERGIC3 could provide a framework for developing effective cancer therapies, particularly for lung cancer.

How can researchers investigate ERGIC3 protein interactions in Danio rerio?

To investigate ERGIC3 protein interactions in Danio rerio, researchers can employ several complementary approaches:

• Co-Immunoprecipitation (Co-IP):

  • Use anti-ERGIC3 antibodies to precipitate ERGIC3 along with its binding partners

  • Identify interacting proteins through mass spectrometry analysis

  • Validate interactions with Western blotting using antibodies against suspected binding partners

• Proximity-Based Labeling:

  • Generate fusion proteins of ERGIC3 with BioID or APEX2

  • Express these constructs in zebrafish cells or transgenic zebrafish

  • Identify proteins in close proximity to ERGIC3 through biotinylation and subsequent purification

• Yeast Two-Hybrid Screening:

  • Use Danio rerio ERGIC3 as bait to screen zebrafish cDNA libraries

  • Validate positive interactions with complementary methods

• Fluorescence Resonance Energy Transfer (FRET):

  • Create fluorescent protein fusions with ERGIC3 and candidate interacting proteins

  • Analyze protein-protein interactions in living cells using confocal microscopy

• Bioinformatic Analysis:

  • Map differentially expressed proteins to the STRING database

  • Visualize and analyze protein-protein interaction networks using Cytoscape

  • Identify hub genes and key functional modules through MCODE and Cytohubba plugins

Research has shown that ERGIC3 interacts with proteins localized to both ER and Golgi apparatus, which can be identified through these techniques . When analyzing interaction networks, researchers should employ appropriate statistical methods and visualization tools to identify significant interactions and functional clusters.

How can Danio rerio ERGIC3 studies inform human disease research?

Danio rerio ERGIC3 studies provide valuable insights for human disease research due to the significant genetic similarities between zebrafish and humans. These studies can inform human disease research through several mechanisms:

• Genetic Conservation: Zebrafish share 70% of their genes with humans and possess more than 84% of the genes that cause genetic disease in humans . This genetic similarity makes zebrafish ERGIC3 studies highly relevant for understanding human ERGIC3 function and dysfunction.

• Cancer Research: ERGIC3 overexpression has been linked to various human cancers, including lung cancer, colorectal tumors, and hepatocellular carcinoma . Zebrafish studies on ERGIC3's role in cell proliferation, migration, and epithelial-to-mesenchymal transition can provide mechanistic insights into these processes in human cancers.

• Therapeutic Target Validation: Research demonstrating that knockdown of ERGIC3 suppresses tumor growth in zebrafish models suggests that targeting ERGIC3 might be a viable therapeutic strategy for human cancers . The zebrafish model allows for rapid in vivo validation of ERGIC3 as a potential drug target.

• Drug Discovery Platform: Zebrafish embryos can serve as an efficient platform for screening compounds that modulate ERGIC3 function, potentially identifying lead compounds for human therapeutics.

• Developmental Disorders: Given ERGIC3's role in ER-Golgi trafficking, zebrafish studies can illuminate how disruptions in this pathway contribute to human developmental disorders associated with protein trafficking defects.

What immune function relationships have been identified for ERGIC3?

Recent research has uncovered significant relationships between ERGIC3 and immune function:

• Immune Cell Infiltration: ERGIC3 expression has been associated with the abundance of tumor immune infiltrates, including B cells, CD8+ T cells, CD4+ T cells, macrophages, neutrophils, and myeloid dendritic cells as analyzed through the TIMER database .

• Inflammatory Signaling: Bioinformatic analysis of differentially expressed proteins after ERGIC3 knockdown reveals involvement in I-kappa B kinase/NF-kappa B signal transduction pathways, which are central to immune and inflammatory responses .

• Novel Immune Function Gene: ERGIC3 has been identified as a novel immune function-related gene, with potential implications for understanding immune responses in both normal physiology and disease states .

• Cancer Immunobiology: The association between ERGIC3 expression and immune cell infiltration in tumors suggests a potential role in modulating the tumor immune microenvironment, which has significant implications for cancer immunotherapies.

• Stress Response: ERGIC3's involvement in ER stress responses and autophagy indicates it may play a role in cellular stress pathways that intersect with immune function, particularly in conditions characterized by chronic inflammation .

These findings suggest that ERGIC3 may represent a novel target for modulating immune responses in various disease contexts, including cancer and inflammatory disorders.

What are common challenges in recombinant Danio rerio ERGIC3 production and how can they be overcome?

Producing recombinant Danio rerio ERGIC3 presents several technical challenges that researchers should anticipate and address:

• Protein Solubility and Folding Issues:

  • Challenge: As a transmembrane protein, ERGIC3 may form inclusion bodies or aggregate during expression.

  • Solution: Consider expression in mammalian or baculovirus systems over E. coli for better folding . Use solubility tags like MBP or SUMO. Express truncated versions excluding transmembrane domains for structural studies.

• Post-translational Modifications:

  • Challenge: Important modifications may be absent in simpler expression systems.

  • Solution: For studies requiring native post-translational modifications, use mammalian cell expression systems. For biotinylation, implement AviTag-BirA technology for site-specific modification .

• Protein Purification Complications:

  • Challenge: Membrane proteins can be difficult to extract and purify.

  • Solution: Optimize detergent selection for solubilization. Consider using histidine tags (His-tag) for immobilized metal affinity chromatography (IMAC) purification. Include protease inhibitors to prevent degradation during purification.

• Low Expression Yields:

  • Challenge: Membrane proteins often express at lower levels than soluble proteins.

  • Solution: Optimize codon usage for the expression system. Test multiple expression conditions (temperature, induction time, media composition). Consider using strong inducible promoters and specialized expression strains.

• Functional Verification:

  • Challenge: Confirming that recombinant ERGIC3 retains native functionality.

  • Solution: Develop activity assays based on known functions, such as binding to interaction partners or participation in vesicle trafficking. Perform structural studies to confirm proper folding.

How can researchers optimize RNA-seq analysis after ERGIC3 manipulation in zebrafish models?

Optimizing RNA-seq analysis after ERGIC3 manipulation requires careful attention to experimental design, quality control, and analytical approaches:

• Experimental Design and Sample Preparation:

  • Include at least three biological replicates per condition to ensure statistical power

  • Validate knockdown efficiency by qRT-PCR before proceeding to RNA-seq

  • Extract high-quality RNA using RNAiso Plus or comparable reagents

  • Monitor RNA quality using RNA integrity number (RIN) measures, targeting RIN > 8

• Library Preparation and Sequencing:

  • Select appropriate library preparation method based on research goals

  • Consider strand-specific protocols for improved gene identification

  • Determine adequate sequencing depth (30-50 million reads per sample for differential expression)

  • Monitor sequencing quality metrics, including:

    • Clean reads Q20 percentage (>98%)

    • Clean reads Q30 percentage (>95%)

    • Total genome mapping ratio (>85%)

• Bioinformatic Analysis Pipeline:

  • Perform quality control using FastQC

  • Trim low-quality bases and adapter sequences

  • Align reads to the zebrafish reference genome using STAR or similar aligners

  • Quantify gene expression with tools like featureCounts or RSEM

  • Normalize counts appropriately (e.g., TPM, FPKM)

  • Identify differentially expressed genes using DESeq2 or edgeR with appropriate thresholds:

    • Fold Change ≥ 2.00

    • Adjusted P-value ≤ 0.05

• Functional Interpretation:

  • Perform Gene Ontology (GO) enrichment analysis

  • Conduct pathway analysis using KEGG, Reactome, or similar resources

  • Create visualization tools such as volcano plots, heatmaps, and pathway maps

  • Validate key findings using qRT-PCR or protein expression analysis

This methodology has been successfully applied in studies examining transcriptional changes following ERGIC3 knockdown, providing valuable insights into its cellular functions and downstream effects .