Recombinant Danio rerio Mitoferrin-2 (slc25a28)

How should recombinant Danio rerio Mitoferrin-2 be stored and reconstituted for optimal stability?

For optimal stability, store recombinant Danio rerio Mitoferrin-2 protein at -20°C or -80°C upon receipt. Aliquoting is essential to prevent protein degradation from multiple freeze-thaw cycles. When preparing to use the protein:

• Briefly centrifuge the vial before opening to bring contents to the bottom

• Reconstitute the lyophilized protein in deionized sterile water to a concentration of 0.1-1.0 mg/mL

• Add glycerol to a final concentration of 5-50% (typically 50% is recommended) to prevent freeze damage

• Aliquot for long-term storage at -20°C/-80°C

• For short-term use, working aliquots can be stored at 4°C for up to one week

Repeated freezing and thawing should be avoided as it can lead to protein denaturation and loss of activity. The protein is typically prepared in a Tris/PBS-based buffer with 6% trehalose at pH 8.0 for stability .

What are the validated experimental methods to study Mitoferrin-2 function in zebrafish models?

To study Mitoferrin-2 function in zebrafish models, several experimental approaches have been validated:

• Gene expression analysis: Quantitative reverse transcription PCR (qRT-PCR) can be used to quantify Mitoferrin-2 expression using specific primers (Forward primer: TCGTCAAGCAGAGGATGCAGAT; Reverse primer: GTTAAAGTGCTCTTGCAGGAAC)

• Knockdown/knockout studies: CRISPR/Cas9-mediated gene knockout or RNA interference techniques can be employed to reduce or eliminate Mitoferrin-2 expression and assess phenotypic consequences

• Competition assays: Mixing cells expressing control sgRNA with cells expressing Mitoferrin-2-targeting sgRNA (70:30 ratio) to assess growth advantages/disadvantages

• Colony formation assays: To evaluate the effect of Mitoferrin-2 manipulation on cell proliferation capacity

• Immunofluorescence: To examine subcellular localization and potential co-localization with mitochondrial markers

• Iron transport assays: To directly measure the effect of Mitoferrin-2 on mitochondrial iron uptake using iron isotopes or fluorescent iron analogs

These methodologies provide complementary approaches to understanding Mitoferrin-2 function in both normal development and pathological conditions.

How can researchers effectively distinguish between the functions of Mitoferrin-1 and Mitoferrin-2 in experimental systems?

Distinguishing between Mitoferrin-1 and Mitoferrin-2 functions requires careful experimental design:

• Selective genetic manipulation: Use precise gene targeting approaches (CRISPR/Cas9 or RNA interference) with isoform-specific sequences. For Mitoferrin-1, validated primers include: Forward: TTGAATCCAGATCCCAAAGC; Reverse: GTTTCCTTGGTGGCTGAAAA. For Mitoferrin-2: Forward: TCGTCAAGCAGAGGATGCAGAT; Reverse: GTTAAAGTGCTCTTGCAGGAAC

• Expression pattern analysis: Examine tissue-specific expression patterns, as Mitoferrin-1 tends to be more highly expressed in erythroid tissues while Mitoferrin-2 shows broader distribution in non-erythroid cells

• Double knockdown/knockout experiments: Create single and double knockouts to identify unique and redundant functions

• Rescue experiments: Perform functional rescue experiments with each isoform to determine specificity of action

• Competition assays: Use competition-based approaches where cells with single knockouts of either Mitoferrin-1 or Mitoferrin-2 are compared with double knockouts to identify synthetic lethal interactions

Research has demonstrated that while both proteins transport iron into mitochondria, they often have tissue-specific roles and different expression patterns in response to iron availability and developmental stages .

What is the role of Mitoferrin-2 in iron homeostasis and how does it differ across species?

Mitoferrin-2 (SLC25A28) plays a crucial role in iron homeostasis by facilitating iron transport across the mitochondrial inner membrane for processes including heme synthesis and iron-sulfur cluster biogenesis. Its functions across species include:

• In zebrafish (Danio rerio): Mitoferrin-2 functions primarily in non-erythroid cells for mitochondrial iron import. It ensures proper iron availability for mitochondrial processes while working alongside Mitoferrin-1, which is more abundant in erythroid tissues

• In mammals: Similar to zebrafish, mammalian Mitoferrin-2 is broadly expressed in non-erythroid tissues and maintains basal mitochondrial iron import. Studies suggest it may be a synthetic lethal target in chromosome 8p-deleted cancers, indicating its importance in maintaining cancer cell viability under specific genetic backgrounds

• In plants (Arabidopsis): Interestingly, the Arabidopsis homolog of Mitoferrin-2 (AtMfl1) appears to be involved in chloroplast rather than mitochondrial iron transport. AtMfl1 expression is regulated by iron availability - accumulating under iron excess and decreasing under iron deficiency. Knockout mutants show reduced vegetative growth and altered iron accumulation, suggesting a role in chloroplast iron uptake

These differences highlight the evolutionary adaptation of iron transport mechanisms across kingdoms while maintaining the core function of organellar iron transport.

How does Mitoferrin-2 contribute to cellular responses during oxidative stress?

Mitoferrin-2 plays a significant role in cellular responses to oxidative stress through several mechanisms:

Understanding these relationships provides insight into potential therapeutic approaches for conditions characterized by oxidative stress and mitochondrial dysfunction .

What are the experimental considerations for investigating Mitoferrin-2 as a synthetic lethal target in cancer research?

Investigating Mitoferrin-2 as a synthetic lethal target in cancer research, particularly in tumors with chromosome 8p deletions, requires careful experimental design:

• Validation of genetic context: Confirm chromosome 8p deletion status in cell lines and patient samples using techniques such as fluorescent in situ hybridization (FISH), comparative genomic hybridization (CGH), or next-generation sequencing

• Genetic manipulation approaches: Employ multiple orthogonal gene targeting strategies:

  • Short hairpin RNA-mediated gene knockdown

  • CRISPR/Cas9-mediated gene knockout

  • Small molecule inhibitors (if available)

• In vitro functional assays:

  • Colony formation assays to assess long-term proliferation capacity

  • Competition assays mixing cells with and without Mitoferrin-2 targeting

  • Cell viability assays (e.g., MTT) under various stress conditions

  • Apoptosis and cell death measurements

• In vivo validation:

  • Xenograft models using chromosome 8p-deleted tumors with and without Mitoferrin-2 manipulation

  • Patient-derived xenograft models to maintain tumor heterogeneity

  • Assessment of tumor growth, metastasis, and response to standard therapies

• Mechanistic investigations:

  • Iron transport measurements

  • Mitochondrial function assessment (oxygen consumption, membrane potential)

  • ROS production quantification

  • Metabolic profiling

• Combination approaches:

  • Testing synergy with standard-of-care treatments

  • Identifying other synthetic lethal interactions

These approaches provide a comprehensive framework for evaluating Mitoferrin-2 as a potential therapeutic target in cancers with specific genetic alterations .

How can researchers effectively study the relationship between Mitoferrin-2 and metabolic disorders?

To effectively investigate the relationship between Mitoferrin-2 and metabolic disorders such as obesity and diabetes, researchers should consider the following comprehensive approach:

• Animal models with altered Mitoferrin-2 expression:

  • Generate or utilize transgenic models with Mitoferrin-2 overexpression or knockdown

  • Administer adenovirus vectors containing SLC25A28 (like Ad-SLC25A28) via tail vein injection in mice

  • Compare findings with control models (e.g., using Ad-green fluorescent protein)

• Metabolic phenotyping:

  • Track body weight changes over extended periods (e.g., 16 weeks)

  • Analyze adipose tissue morphology in both white and brown adipose tissues

  • Measure serum triglyceride levels and glucose tolerance

  • Assess insulin sensitivity through tolerance tests

• Molecular analysis:

  • Examine protein expression of lipogenesis markers

  • Quantify lipolysis markers, particularly adipose triglyceride lipase (ATGL)

  • Evaluate brown adipose tissue formation markers (UCP-1, PGC-1α)

  • Measure serum adipokines (adiponectin, fibroblast growth factor 21)

• Mechanistic investigations:

  • Explore the relationship between mitochondrial iron levels and adipocyte differentiation

  • Investigate how altered iron homeostasis affects energy expenditure

  • Examine changes in mitochondrial function and biogenesis

• Translational relevance:

  • Compare findings in animal models with human adipose tissue samples

  • Correlate SLC25A28 expression with markers of metabolic disease in patient cohorts

Research has demonstrated that SLC25A28 overexpression promotes diet-induced obesity and accelerates lipid accumulation by regulating hormone secretion and inhibiting lipolysis in adipose tissue, particularly by reducing ATGL expression .

What technical challenges exist in purifying and stabilizing recombinant Mitoferrin-2 for structural studies?

Purifying and stabilizing recombinant Mitoferrin-2 for structural studies presents several technical challenges that researchers must address:

• Expression system optimization:

  • E. coli is commonly used but may not provide proper post-translational modifications

  • The protein is typically expressed with an N-terminal His tag for purification purposes

  • Expression levels may be limited due to the membrane protein nature of Mitoferrin-2

• Solubilization and purification challenges:

  • As a mitochondrial membrane protein, Mitoferrin-2 requires careful detergent selection for solubilization

  • Finding the optimal detergent that maintains protein structure while allowing purification

  • Potential for protein aggregation during concentration steps

  • Need for specialized chromatography approaches beyond standard His-tag affinity purification

• Stability considerations:

  • The lyophilized protein must be properly reconstituted to maintain structure

  • Addition of 5-50% glycerol is recommended for storage stability

  • Storage buffer composition (Tris/PBS-based buffer with 6% trehalose at pH 8.0) is critical

  • Avoiding repeated freeze-thaw cycles is essential to prevent denaturation

• Structural study preparations:

  • For crystallography, finding conditions that promote crystal formation without precipitation

  • For cryo-EM, ensuring proper particle distribution and orientation

  • For NMR studies, achieving sufficient isotopic labeling while maintaining protein folding

• Functional validation:

  • Confirming that the purified protein retains iron transport activity

  • Developing assays to verify proper folding and function before structural analysis

Researchers typically use His-tagged recombinant proteins expressed in E. coli, with careful attention to reconstitution in deionized sterile water to concentrations of 0.1-1.0 mg/mL, and addition of glycerol for long-term storage .

How do the functions of Mitoferrin-2 homologs differ between vertebrates and plants?

The functions of Mitoferrin-2 homologs show fascinating evolutionary divergence between vertebrates and plants:

• Subcellular localization:

  • In vertebrates (e.g., zebrafish, humans): Mitoferrin-2 (SLC25A28) localizes to the inner mitochondrial membrane where it functions as a mitochondrial iron importer

  • In plants (e.g., Arabidopsis): The Mitoferrin-2 homolog AtMfl1 (encoded by At5g42130) surprisingly localizes to the inner chloroplastic envelope membrane rather than mitochondria, as confirmed by multiple proteome analyses

• Response to iron availability:

  • Vertebrate Mitoferrin-2: Expression patterns in response to iron vary by tissue type and developmental stage

  • Plant AtMfl1: Shows clear iron-dependent expression, with strong accumulation under iron excess, moderate expression under iron sufficiency, and weak expression under iron deficiency

• Functional roles:

  • Vertebrate Mitoferrin-2: Primarily involved in non-erythroid mitochondrial iron import for processes like heme synthesis and iron-sulfur cluster formation

  • Plant AtMfl1: Appears to be involved in iron transport into chloroplasts rather than mitochondria. AtMfl1 knockout mutants show reduced vegetative growth and decreased total iron content when grown under iron excess conditions

• Physiological impact of deficiency:

  • Vertebrate Mitoferrin-2: Deficiency may be compensated by Mitoferrin-1 in some tissues but can lead to mitochondrial iron deficiency in others

  • Plant AtMfl1: Knockout mutants (atmfl1-1 and atmfl1-2) show reduced vegetative growth and decreased expression of the iron storage protein ferritin (AtFer1)

These differences highlight how iron transport mechanisms have evolved to meet the specific needs of different kingdoms, with plants adapting the mitoferrin-like transporters for chloroplast function, likely reflecting the critical importance of iron in photosynthesis .

What are the most common technical issues encountered when working with recombinant Mitoferrin-2 and how can they be addressed?

Researchers frequently encounter several technical challenges when working with recombinant Mitoferrin-2. Here are the most common issues and their solutions:

• Protein solubility problems:

  • Issue: As a membrane protein, Mitoferrin-2 can aggregate during reconstitution

  • Solution: Reconstitute slowly in cold buffer, add detergents appropriate for membrane proteins (e.g., n-dodecyl β-D-maltoside or digitonin at 0.1-1%), and avoid vigorous shaking or vortexing

• Loss of activity after storage:

  • Issue: Protein losing functionality after freeze-thaw cycles

  • Solution: Aliquot into single-use volumes before freezing, add 50% glycerol as cryoprotectant, and store at -80°C rather than -20°C for long-term storage. Working aliquots should be kept at 4°C for no more than one week

• Inconsistent experimental results:

  • Issue: Variable outcomes in functional assays

  • Solution: Verify protein integrity by SDS-PAGE before each experiment, standardize protein concentration determination methods, and include positive controls in each experimental batch

• Challenges in detecting protein-protein interactions:

  • Issue: Difficulty capturing transient or weak interactions

  • Solution: Use crosslinking approaches, try multiple co-immunoprecipitation techniques with different detergents, or consider proximity labeling methods like BioID

• Specificity concerns in functional assays:

  • Issue: Distinguishing between Mitoferrin-1 and Mitoferrin-2 effects

  • Solution: Use isoform-specific inhibitors or genetic approaches, include careful controls, and perform rescue experiments with each isoform separately

• Issues with antibody specificity:

  • Issue: Cross-reactivity between Mitoferrin isoforms

  • Solution: Validate antibodies using knockout controls, consider epitope-tagged versions of the protein, or use mass spectrometry-based approaches for detection

Addressing these technical challenges requires careful optimization of experimental conditions and validation of reagents to ensure reliable and reproducible results when working with recombinant Mitoferrin-2 .

How can researchers troubleshoot inconsistent results in Mitoferrin-2 knockdown experiments?

When encountering inconsistent results in Mitoferrin-2 knockdown experiments, researchers should systematically troubleshoot using the following approach:

• Verify knockdown efficiency:

  • Quantify mRNA levels using qRT-PCR with validated primers (Forward: TCGTCAAGCAGAGGATGCAGAT; Reverse: GTTAAAGTGCTCTTGCAGGAAC)

  • Confirm protein reduction by western blot with specific antibodies

  • Consider temporal aspects, as knockdown efficiency may vary over time

• Evaluate off-target effects:

  • Use multiple knockdown strategies (different siRNAs, shRNAs, or sgRNAs)

  • Include appropriate non-targeting controls

  • Consider rescue experiments by expressing knockdown-resistant versions of Mitoferrin-2

• Assess compensatory mechanisms:

  • Check for upregulation of Mitoferrin-1 or other iron transporters that might compensate for Mitoferrin-2 loss

  • Examine expression changes in iron-responsive genes

  • Consider double knockdown experiments (e.g., Mitoferrin-1 and Mitoferrin-2)

• Standardize experimental conditions:

  • Control cell density and passage number

  • Standardize culture conditions, including medium composition and serum batch

  • Consider the impact of iron levels in culture media on experimental outcomes

• Optimize assay timing:

  • Determine the optimal timepoint for phenotypic assessment after knockdown

  • Perform time-course experiments to capture transient effects

  • For doxycycline-inducible systems, maintain consistent doxycycline exposure (1 μg/mL, changed every 48 hours)

• Consider cell type-specific effects:

  • Different cell types may respond differently to Mitoferrin-2 knockdown

  • Compare results across multiple cell lines or primary cells

  • Account for baseline iron requirements of different cell types

Research has shown that competition assays with a 30:70 ratio of control to Mitoferrin-2 knockdown cells can provide more sensitive detection of phenotypic effects than direct viability measurements in some experimental contexts .

What are the emerging applications of Mitoferrin-2 research in understanding mitochondrial diseases?

Emerging research on Mitoferrin-2 is revealing important connections to mitochondrial diseases through several innovative approaches:

• Role in mitochondrial iron homeostasis disorders:

  • New evidence suggests Mitoferrin-2 dysfunction may contribute to conditions characterized by mitochondrial iron overload or deficiency

  • Research is exploring connections to Friedreich's ataxia, sideroblastic anemia, and other iron-related mitochondrial disorders

  • The protein's involvement in ROS generation during stress conditions suggests potential roles in oxidative damage pathways common in mitochondrial diseases

• Integration with mitochondrial quality control:

  • Emerging research examines how Mitoferrin-2-mediated iron transport interfaces with mitochondrial dynamics (fusion/fission) and mitophagy

  • Preliminary evidence suggests iron status influences mitochondrial quality control processes

  • Studies are exploring how Mitoferrin-2 activity might be modulated to improve mitochondrial function in disease states

• Therapeutic targeting approaches:

  • Development of small molecule modulators of Mitoferrin-2 activity for potential therapeutic applications

  • Investigation of iron chelation therapies that specifically target mitochondrial iron pools

  • Exploration of gene therapy approaches to correct Mitoferrin-2 dysfunction

• Intersection with metabolic disorders:

  • Novel connections between Mitoferrin-2, iron homeostasis, and metabolic regulation

  • Research shows Mitoferrin-2 overexpression affects adipose tissue metabolism by reducing adipose triglyceride lipase (ATGL) and influencing hormone secretion

  • These findings suggest potential therapeutic strategies for obesity and related metabolic conditions

• Cancer metabolism connections:

  • Emerging evidence for Mitoferrin-2 as a synthetic lethal target in chromosome 8p-deleted cancers

  • Investigation of how mitochondrial iron import influences cancer cell metabolism

  • Exploration of combination therapies targeting iron homeostasis alongside traditional cancer treatments

These emerging research directions highlight the expanding significance of Mitoferrin-2 in understanding and potentially treating a wide range of mitochondrial diseases and related disorders.

How might Mitoferrin-2 research contribute to developing novel therapeutic approaches for iron-related disorders?

Mitoferrin-2 research is opening promising avenues for novel therapeutic approaches targeting iron-related disorders:

• Targeted mitochondrial iron modulation:

  • Development of small molecules that specifically modulate Mitoferrin-2 activity rather than affecting global iron pools

  • Potential applications in conditions with mitochondrial iron overload or deficiency

  • Research into tissue-specific delivery systems to target Mitoferrin-2 in affected tissues while sparing others

• Cancer therapeutics:

  • Exploitation of synthetic lethality in tumors with chromosome 8p deletions

  • Research shows that targeting Mitoferrin-2 in these genetic contexts may selectively kill cancer cells while sparing normal tissues

  • Development of combination approaches with standard chemotherapies or radiation to enhance efficacy

• Metabolic disorder interventions:

  • Modulation of Mitoferrin-2 to influence adipose tissue metabolism

  • Research demonstrates that SLC25A28 overexpression promotes diet-induced obesity and accelerates lipid accumulation

  • Potential therapeutic approaches targeting the Mitoferrin-2/ATGL pathway to regulate adipose tissue function and combat obesity

• Neurodegenerative disease applications:

  • Investigation of Mitoferrin-2's role in neuronal iron homeostasis

  • Development of approaches to protect neurons from iron-mediated oxidative damage

  • Exploration of connections to conditions like Parkinson's and Alzheimer's diseases where iron dysregulation is implicated

• Reactive oxygen species management:

  • Research on Mitoferrin-2's involvement in ROS-dependent mechanisms suggests potential for modulating oxidative stress responses

  • Studies in glioma cells show that silencing Mitoferrin-2 decreased arsenic trioxide-induced apoptosis and cytotoxicity

  • These findings could lead to strategies for protecting normal tissues from oxidative damage while enhancing ROS-based cancer therapies

The continued exploration of Mitoferrin-2 biology promises to yield innovative therapeutic approaches that precisely target iron homeostasis at the mitochondrial level, potentially offering new treatments for a wide range of disorders from cancer to metabolic diseases.