Recombinant Danio rerio Protein Mpv17 (mpv17)

What is Mpv17 and what is its cellular localization in zebrafish?

Mpv17 is a nuclear gene that encodes a mitochondrial inner membrane protein with multiple transmembrane domains. In zebrafish, mpv17 is located on chromosome 20, consists of eight exons, and encodes a 177 amino acid protein . The protein has been definitively localized to the mitochondrial inner membrane through fluorescent protein tagging and confocal microscopy studies . Unlike many mitochondrial proteins, Mpv17 lacks canonical mitochondrial localization sequences and is not processed upon membrane transport or incorporation .

What functions does Mpv17 perform in zebrafish?

Mpv17 plays several critical roles in zebrafish:

• Maintenance of mitochondrial cristae structure and architecture

• Supporting proper oxidative phosphorylation (OXPHOS) system functionality

• Contributing to mitochondrial DNA (mtDNA) maintenance, though this appears to be a consequential rather than primary effect

• Involvement in pyrimidine de novo synthesis pathways

• Development and maintenance of iridophores (guanine-based reflective skin cells)

Research indicates that ultrastructural alterations in mitochondria occur before mtDNA depletion, suggesting that mitochondrial structural integrity is the primary function of Mpv17 .

What are the phenotypic consequences of mpv17 mutations in zebrafish?

Zebrafish with mpv17 mutations display several distinct phenotypes:

• Most visibly, they lack iridophores (guanine-containing reflective skin cells), resulting in the transparent appearance that gives the "roy orbison" and "transparent" mutants their names

• Early and severe ultrastructural alterations in liver mitochondria

• Significant impairment of respiratory chain complexes

• Activation of mitochondrial quality control mechanisms

• mtDNA depletion occurring at later developmental stages (after 3 dpf)

• Abnormalities potentially linked to pyrimidine metabolism, as evidenced by rescue experiments with orotic acid

How do zebrafish mpv17 mutants relate to human disease?

Mutations in MPV17 in humans cause mitochondrial DNA depletion syndromes (MDS), particularly hepatocerebral forms that primarily affect the liver and nervous system . The zebrafish mpv17 mutant serves as a valuable model because:

• The protein shows significant sequence homology to human MPV17

• Both zebrafish and human proteins localize to the inner mitochondrial membrane

• Zebrafish mutants display mitochondrial dysfunction and mtDNA depletion similar to human patients

• The earliest clinical manifestation in humans is liver dysfunction, and zebrafish mpv17 mutants show early liver mitochondrial abnormalities

• The transparency of zebrafish larvae allows for non-invasive monitoring of phenotype progression

What zebrafish mpv17 mutant models are available for research?

Several zebrafish mpv17 mutant models have been characterized:

• "Roy orbison" (roy): Contains a 19 bp deletion causing aberrant splicing between exons 2 and 3

• "Transparent" (tra or tra b6): Phenotypically and molecularly similar to roy, affecting the same gene locus

• CRISPR-Cas9 generated mpv17 mutants: Created using sgRNAs targeting either exon 2 or exon 3, resulting in frameshift mutations

• Morpholino-induced knockdown models: Generated by injecting antisense morpholinos against mpv17

Trans-heterozygote studies have confirmed all these alleles affect the same gene, as they fail to complement each other .

What methods are recommended for generating recombinant Danio rerio Mpv17 protein?

For successful expression and purification of recombinant Mpv17 protein:

• Expression systems:

  • Bacterial systems with specialized membrane protein-compatible strains

  • Insect cell systems for better membrane insertion and folding

  • Cell-free systems for initial construct screening

• Construct design:

  • Include purification tags (His6, GST) with TEV protease cleavage sites

  • Consider truncating transmembrane domains for specific domain studies

  • Remove flexible regions for structural studies

• Solubilization strategies:

  • Use mild detergents like DDM or LMNG for extraction

  • Consider nanodiscs or amphipols for maintaining native conformation

  • Screen multiple detergent:protein ratios

• Purification protocol:

  • Initial capture using affinity chromatography

  • Size exclusion chromatography for secondary purification

  • Maintain cold temperatures (4°C) throughout to minimize degradation

• Validation methods:

  • Circular dichroism to confirm proper folding

  • Thermal shift assays to assess stability

  • Functional reconstitution in liposomes for activity testing

What are the most effective protocols for studying mtDNA maintenance in mpv17-deficient zebrafish?

To study mtDNA maintenance in mpv17-deficient zebrafish:

• Quantification methods:

  • Real-time PCR using mitochondrial gene targets (mt-nd1) vs. nuclear references (polg1)

  • Standard curve method for accurate quantification

  • Sample preparation using PicoGreen assay for DNA quantification

  • Run samples in triplicate with 8.5 ng DNA per reaction using HOT FIREPol EvaGreen qPCR Supermix

• Developmental analysis:

  • Collect samples at multiple timepoints (3-10 dpf) to establish temporal progression

  • Use pooled larvae or microdissected tissues depending on research question

  • Calculate Delta Ct (dCt) by subtracting the Ct of nuclear marker from mitochondrial marker

• Tissue-specific considerations:

  • For liver-specific analysis, consider microdissection or transgenic markers

  • Compare high vs. low energy-demanding tissues to assess differential impacts

  • Correlate with electron microscopy findings for structure-function relationships

How can researchers investigate the relationship between Mpv17 and pyrimidine metabolism?

The connection between Mpv17 and pyrimidine metabolism can be investigated through:

• Metabolite supplementation experiments:

  • Administer orotic acid (OA) to mpv17 mutant embryos (optimal timing: before 24 hpf)

  • Quantitatively assess rescue effects on:

    • Iridophore numbers (visible at 3-4 dpf)

    • mtDNA content using qPCR methods

  • Perform dose-response experiments to determine optimal concentrations

• Metabolomic analysis:

  • Targeted LC-MS/MS analysis of pyrimidine intermediates

  • Comparison between wild-type and mpv17 mutants at various developmental stages

  • Isotope tracing using labeled precursors to track metabolic flux

• Expression analysis:

  • qRT-PCR for enzymes involved in pyrimidine synthesis

  • Focus on rate-limiting steps in the pathway

  • Compare expression in affected vs. unaffected tissues

What approaches are recommended for creating and validating mpv17 transgenic rescue models?

For creating transgenic rescue models:

• Construct design and generation:

  • Clone full-length mpv17 ORF into appropriate vectors (e.g., pCS2+)

  • Generate site-directed mutants using Q5 Site-Directed Mutagenesis Kit

  • For human variants (e.g., p.R50Q), design appropriate primers

  • Example primers for p.R50Q mutation:

    • Forward: CAGAGAGGCCAGACTCTGACCATG

    • Reverse: GTGTTCCTGCAGACCCCG

• mRNA rescue protocol:

  • Transcribe capped mRNA using mMessage mMachine kit

  • Inject into 1-cell stage mutant embryos at 70-100 ng/μl

  • Score for phenotypic rescue (iridophores) at 3-4 dpf

• Stable transgenic generation:

  • Use Tol2 transposase for genomic integration

  • For precise editing, employ CRISPR-Cas9 with HDR templates

  • Screen F0 for mosaic expression and F1 for germline transmission

What methods can distinguish between primary and secondary effects of Mpv17 deficiency?

To differentiate primary from secondary effects:

• Temporal analysis approach:

  • Perform detailed time-course experiments starting at early developmental stages

  • Establish the sequence of events:

    • Mitochondrial membrane potential changes

    • Ultrastructural alterations

    • Respiratory chain dysfunction

    • mtDNA depletion

• Subcellular fractionation and analyses:

  • Isolate mitochondria to assess direct organelle impacts

  • Analyze mitochondrial membrane potential as an early indicator

  • Perform electron microscopy for cristae morphology assessment

  • Quantify respiratory chain complex activities

• Rescue experiment specificity:

  • Compare targeted interventions (metabolite supplementation) with genetic rescue

  • Assess rescue efficiency for different phenotypes:

    • Iridophore development

    • Mitochondrial ultrastructure

    • mtDNA content

    • Respiratory chain function

Current evidence indicates that mitochondrial ultrastructural changes and respiratory chain dysfunction are primary consequences of mpv17 loss, while mtDNA depletion appears to be a secondary effect .

What techniques are most effective for studying interactions between Mpv17 and other mitochondrial proteins?

For investigating Mpv17 protein interactions:

• Proximity-based methods:

  • BioID or TurboID tagging of Mpv17 for in vivo biotinylation of proximal proteins

  • APEX2 proximity labeling for electron microscopy visualization

  • These approaches preserve the native membrane environment

• Cross-linking strategies:

  • Chemical cross-linking followed by mass spectrometry (XL-MS)

  • Use membrane-permeable crosslinkers for intact mitochondria

  • Quantitative SILAC labeling to distinguish specific interactions

• Co-immunoprecipitation adaptations:

  • Optimize mild detergents for membrane protein solubilization

  • Use digitonin-based extraction to preserve membrane protein complexes

  • Include proper controls (untagged samples, irrelevant tagged proteins)

• Genetic interaction screening:

  • Test interactions with MPV17 family members (MPV17L, MPV17L2)

  • Analyze double mutant phenotypes for synthetic effects

  • Consider synthetic genetic array approaches in cell culture models

How does orotic acid supplementation rescue mpv17 mutant phenotypes at the molecular level?

Orotic acid (OA) supplementation rescues mpv17 mutant phenotypes through:

• Pyrimidine pathway effects:

  • OA serves as an intermediate in de novo pyrimidine synthesis

  • Supplementation likely bypasses a rate-limiting step in this pathway

  • Provides building blocks for nucleotide synthesis when Mpv17-dependent processes are compromised

  • May restore balance between purine and pyrimidine pools

• Dual phenotype rescue:

  • OA increases mtDNA content in mpv17 mutants

  • OA also increases iridophore numbers in mutant zebrafish

  • This suggests pyrimidine availability limits both processes

  • Demonstrates connection between mitochondrial function and specialized cell development

• Therapeutic implications:

  • OA is currently used as a food supplement in humans

  • Represents a potential simple intervention for MPV17-related disorders

  • Translation to human studies would require careful dosage optimization

  • Most effective when administered early in disease progression

The discovery that OA can rescue both cellular (iridophores) and molecular (mtDNA) phenotypes provides strong evidence linking Mpv17 function to pyrimidine metabolism and offers potential therapeutic avenues for MPV17-related disorders.

What controls should be included when studying mpv17 mutants?

Proper controls for mpv17 mutant studies include:

• Genetic controls:

  • Wild-type siblings from the same cross

  • Heterozygous carriers to assess dosage effects

  • Rescue with wild-type mpv17 mRNA

  • Rescue with human MPV17 mRNA to test functional conservation

  • Empty vector controls for rescue experiments

• Developmental controls:

  • Age-matched specimens for all comparisons

  • Careful staging based on standard zebrafish developmental markers

  • Time-course analysis to distinguish developmental delays from true defects

• Tissue-specific controls:

  • Comparison between affected (liver) and unaffected tissues

  • Use of tissue-specific markers to ensure proper identification

  • Size/mass normalization when comparing different tissues

• Technical controls:

  • For qPCR: No template controls, reverse transcriptase controls

  • For mtDNA quantification: Multiple reference genes

  • For phenotypic rescue: Dose-response curves

  • For microscopy: Blinded quantification of phenotypes

What are the technical challenges in generating CRISPR/Cas9 mpv17 mutants?

When generating CRISPR/Cas9 mpv17 mutants, researchers should consider:

• sgRNA design considerations:

  • Target early exons (exon 2 or 3) to ensure functional disruption

  • Use tools like CHOPCHOP for optimal design

  • Verify target site conservation and specificity

  • Example successful sgRNA sequences:

    • sgRNA1: 5′-GGTACCAATAGTGCATGAAGGGG-3′

    • sgRNA2: 5′-GGTTGCGTCGCCAACGTTGGGGG-3′ (PAM underlined)

• Delivery methods:

  • Microinjection of solubilized, fluorescent Cas9-sgRNA ribonucleoprotein complexes

  • Injection into single-cell stage embryos

  • Consider co-injection with fluorescent markers for injection quality control

• Validation strategies:

  • PCR and sequencing to confirm mutations

  • T7 endonuclease assays for rapid screening

  • Restriction enzyme digestion if mutation creates/removes a site

  • Phenotypic analysis of iridophores as functional readout

• Genotyping challenges:

  • Design primers that flank the target site

  • Consider heteroduplex mobility assays for screening

  • Establish reliable DNA extraction protocols from fin clips

  • Account for mosaicism in F0 generation

What experimental design is recommended for temporal analysis of mpv17-related phenotypes?

For temporal analysis of mpv17-related phenotypes:

• Sampling strategy:

  • Begin analysis at early developmental stages (24 hpf)

  • Include multiple timepoints: 3, 5, 7, and 10 dpf as standard points

  • Collect samples for both molecular and morphological analyses at each timepoint

  • Maintain consistent sampling times to avoid circadian effects

• Data collection matrix:

  Age	Iridophores	mtDNA content	Mitochondrial morphology	RC activity
  3 dpf	Count	qPCR	TEM	Spectrophotometry
  5 dpf	Count	qPCR	TEM	Spectrophotometry
  7 dpf	Count	qPCR	TEM	Spectrophotometry
  10 dpf	Count	qPCR	TEM	Spectrophotometry

• Statistical considerations:

  • Use sufficient biological replicates (n≥3 pools of 10+ larvae)

  • Apply appropriate statistical tests for time series data

  • Consider regression analysis to identify inflection points

  • Normalize data appropriately for developmental changes

• Imaging protocols:

  • Standardize imaging parameters across timepoints

  • Use identical anatomical regions for comparison

  • Implement blinded quantification methods

  • Consider automated high-throughput imaging when possible

How can new mpv17 paralogue studies inform our understanding of its function?

The MPV17 protein family includes several paralogues (MPV17L, MPV17L2, and PXMP2) that can provide insights into Mpv17 function:

• Comparative functional analysis:

  • MPV17 and MPV17L2 both localize to the inner mitochondrial membrane

  • MPV17L may be found in peroxisomes or mitochondria with antioxidant functions

  • PXMP2 localizes to peroxisomes as a non-selective channel

  • Sequence comparison shows MPV17L2 has the highest similarity to MPV17

• Evolutionary implications:

  • Gene duplication events in early metazoan evolution gave rise to these paralogues

  • MPV17L and MPV17L2 are sister groups phylogenetically

  • Functional divergence suggests specialized roles in different membrane systems

  • Conservation patterns can identify critical functional domains

• Research approaches:

  • Generate and characterize mutants for each paralogue

  • Create double/triple mutants to assess functional redundancy

  • Perform cross-rescue experiments (can one paralogue rescue another's function?)

  • Use chimeric proteins to identify functional domains

• MPV17L2 insights:

  • May contribute to mitochondrial ribosome biogenesis

  • Links ribosomal subunits to create translationally competent monosomes

  • Abundance depends on mtDNA (absent from ρ0 cells)

  • Represents a potentially important connection between translation and MPV17 function

What therapeutic strategies can be developed based on mpv17 zebrafish research?

Zebrafish mpv17 research suggests several therapeutic approaches:

• Metabolic supplementation:

  • Orotic acid administration ameliorates both iridophore and mtDNA phenotypes

  • Represents a simple, potential intervention already used as a food supplement

  • Could be rapidly translated to clinical trials for MPV17-related MDS

• Genetic therapies:

  • Successful mRNA rescue in zebrafish suggests gene therapy potential

  • Adeno-associated virus (AAV) vectors could target liver, the primary affected tissue

  • CRISPR-based approaches could correct specific mutations

• Drug screening opportunities:

  • Zebrafish mpv17 mutants provide an excellent platform for high-throughput screening

  • Visible iridophore phenotype allows for rapid assessment of rescue

  • Compounds enhancing pyrimidine synthesis or mitochondrial function are candidates

  • Repurposing of existing drugs that modulate pyrimidine metabolism

• Combinatorial approaches:

  • Metabolite supplementation plus mitochondrial protective agents

  • Targeting both pyrimidine synthesis and mitochondrial quality control

  • Stage-specific interventions based on disease progression

The zebrafish model offers unique advantages for therapeutic development, including rapid assessment of developmental toxicity, whole-organism effects, and visible phenotypic readouts for efficacy .