This enzyme subunit (commonly abbreviated as NqrE) is a critical component of the bacterial Na(+)-NQR complex, a respiratory sodium pump that couples NADH oxidation with quinone reduction to generate a sodium motive force. While extensively studied in Vibrio species (V. cholerae, V. fischeri) and Pseudoalteromonas atlantica , no peer-reviewed studies or commercial protein entries explicitly mention its recombinant expression or characterization in Dichelobacter nodosus.
The genome of D. nodosus JKS-07B encodes RnfB, a component of an Rnf-like electron transport complex, but no homologs of Na(+)-NQR subunits were identified in available annotations .
Primary respiratory enzymes in D. nodosus focus on protease production (e.g., AprV2, AprB5) rather than sodium-pumping NADH dehydrogenases .
Biological Relevance: Dichelobacter nodosus, a pathogen causing ovine footrot, primarily relies on fermentative metabolism and protease secretion for virulence. Sodium-dependent respiration may not be central to its physiology .
Research Gaps: No studies have reported cloning, expression, or functional characterization of Na(+)-NQR subunits in this organism.
To investigate Recombinant Dichelobacter nodosus NqrE:
Genomic Mining: Verify the presence of nqrE homologs in D. nodosus genomes using tools like BLAST or InterPro (IPR008703, IPR022615).
Heterologous Expression: Clone putative nqrE genes into E. coli or Vibrio expression systems (e.g., pET or pBAD vectors) and purify via His-tag affinity chromatography .
Functional Assays: Test NADH:quinone oxidoreductase activity in the presence of Na+ ions and compare kinetics to Vibrio NqrE .
KEGG: dno:DNO_0807
STRING: 246195.DNO_0807
Na(+)-translocating NADH:quinone oxidoreductase (NQR) is a membrane-bound respiratory enzyme complex that serves as the main producer of sodium motive force (SMF) in D. nodosus. The complex catalyzes electron transfer from NADH to ubiquinone, coupled with Na+ translocation across the bacterial membrane . This process drives crucial energy-dissipating cellular functions including:
Flagellar rotation
Substrate uptake
ATP synthesis
Cation-proton antiport
In the respiratory chain of pathogenic bacteria like D. nodosus, NQR plays a central role in energy metabolism by converting the energy from NADH oxidation into an electrochemical sodium gradient. This gradient is subsequently used by the bacterial cell for various energy-requiring processes, making the enzyme essential for bacterial viability .
Successful expression and purification of recombinant D. nodosus NqrE requires specific methodological considerations due to the transmembrane nature of the protein:
Expression System Selection:
E. coli BL21(DE3) strain is recommended using pET expression vectors (pET32a) for thioredoxin-tagged fusion proteins
Cell-free expression systems may be beneficial for transmembrane proteins with toxicity issues
Expression Protocol:
Transform the expression construct into E. coli BL21(DE3)
Culture in LB medium supplemented with 1% glucose to reduce toxicity to host cells
Induce expression with IPTG (0.1-0.5 mM) when OD600 reaches 0.6-0.8
Continue incubation at lower temperature (16-25°C) for 16-20 hours to improve protein folding
Harvest cells by centrifugation at 5,000 × g for 10 minutes
Purification Strategy:
Resuspend cell pellet in lysis buffer containing appropriate detergents (e.g., SDS or mild non-ionic detergents)
Disrupt cells via sonication or mechanical methods
Clarify lysate by centrifugation at 12,000 × g for 20 minutes
Purify using Ni-NTA affinity chromatography under native conditions for His-tagged proteins
Elute with increasing concentrations of imidazole (250-500 mM)
Analyze purity by SDS-PAGE and confirm identity by Western blotting using anti-His antibodies
Important Considerations:
The addition of 1% glucose to growth media is crucial as recombinant NqrE can be toxic to host cells
Repeated freeze-thaw cycles of cell lysate can increase protein yield
For optimal results, purification should be performed at 4°C to minimize protein degradation
Buffer composition should include stabilizers such as glycerol (20-50%) for long-term storage
Working with recombinant D. nodosus NqrE presents several technical challenges that researchers should anticipate:
Evidence: Transformed BL21 cells show poor growth on LB/ampicillin agar without glucose supplementation
Solution: Add 1% glucose to growth media to suppress basal expression and reduce toxicity
Evidence: Decline in turbidity of induced cultures compared to uninduced controls
Solutions:
Use C41(DE3) or C43(DE3) E. coli strains specifically designed for toxic membrane proteins
Optimize induction conditions (lower IPTG concentration, lower temperature)
Consider codon optimization for E. coli expression
Evidence: NqrE proteins do not assemble into mature structures in E. coli and require detergents for extraction
Solutions:
Use appropriate detergents (SDS, DDM, or LDAO) for membrane protein solubilization
Incorporate freeze-thaw cycles to increase protein release from cellular membranes
Extend incubation time post-induction to improve yields
Evidence: Membrane proteins often lose native structure during purification
Solutions:
Use milder detergents for purification steps
Include stabilizing agents (glycerol, specific lipids) in purification buffers
Consider nanodiscs or liposomes for reconstitution of purified protein
Solutions:
Store in buffer containing 20-50% glycerol at -20°C/-80°C
Avoid repeated freeze-thaw cycles of purified protein
Aliquot protein samples before freezing
The NQR complex has been shown to significantly impact iron homeostasis in bacterial pathogens, with potential implications for D. nodosus virulence:
NQR's Connection to Iron Metabolism:
In Vibrio cholerae, deletion of the NQR complex (Δnqr) results in upregulation of iron transport systems, particularly the ferrous iron transporter FeoB (2.7-fold increase)
NQR mutants show improved growth rates with Fe2+ as an iron source
The nqr operon is induced by iron in wild-type bacteria, suggesting a regulatory feedback mechanism
Molecular Mechanisms:
The NQR complex contains Fe-S clusters as essential cofactors
In NQR-deficient mutants, the bacterial response includes upregulation of iron acquisition systems to compensate for metabolic changes
The membrane-bound subunits NqrD and NqrE ligate an Fe center within the membrane part of the complex
Implications for D. nodosus Virulence:
Iron acquisition is critical for bacterial pathogens in iron-limited host environments
Alteration of NQR function may affect energy metabolism and iron homeostasis simultaneously
This dual role makes NQR a potential drug target for antibiotics against D. nodosus infections
The table below summarizes the differential regulation of iron transport proteins observed in NQR deletion mutants compared to wild-type bacteria:
| Protein ID | Gene | Protein Description | Relative Change in Δnqr |
|---|---|---|---|
| A0A0H3AKG5 | fhuC | Fe3+-ferrichrome ABC transporter | +4.1 |
| A0A0H3AFY3 | feoB | Fe2+ transport protein | +2.7 |
| A0A0H3AJZ5 | fbpA | Fe3+ periplasmic binding protein | -2.1 |
| A5F661 | viuA | Fe3+-vibriobactin outer membrane transporter | No change |
| A0A0H3AHM4 | viuP | Fe3+-vibriobactin binding protein | No change |
Table based on proteome analysis data from V. cholerae wild-type vs. Δnqr strains
Understanding these interactions may facilitate the development of novel approaches to control D. nodosus infections in sheep.
To effectively investigate NqrE function in D. nodosus footrot pathogenesis, researchers should consider a multi-faceted approach combining various methodological strategies:
Genetic Manipulation Techniques:
Gene Deletion/Knockout
Create precise nqrE deletion mutants using allelic exchange methods
Assess growth characteristics and virulence phenotypes in comparison to wild-type strains
Complementation Studies
Introduce functional nqrE gene in trans to confirm phenotype specificity
Use inducible expression systems to control NqrE levels
Site-Directed Mutagenesis
Target conserved amino acid residues predicted to be involved in Na+ binding or electron transport
Create point mutations to identify critical functional domains
Molecular and Biochemical Approaches:
Protein-Protein Interaction Studies
Co-immunoprecipitation to identify interaction partners within the NQR complex
Bacterial two-hybrid systems to validate protein interactions
Electron Transport Measurements
Assess NADH oxidation rates and ubiquinone reduction in isolated membranes
Measure Na+ transport using fluorescent dyes or radioactive Na+ isotopes
Virulence Assessment Methods:
In Vitro Models
Evaluate proteolytic activity using gelatin gel tests, which correlate with virulence
Assess biofilm formation and adhesion to keratinocytes or hoof tissue explants
Multiple Locus Variable Number Tandem Repeat Analysis (MLVA)
MLVA primers for D. nodosus strain typing:
| DNTR Locus | Forward Primer (5'-3') | Reverse Primer (5'-3') | Expected Size Range (bp) |
|---|---|---|---|
| DNTR02 | CTGCACACGCAACGTTTACA | GGCGAACGCCTACTGTATCA | Variable |
| DNTR09 | GAAGTTTGTGAGGCTATCC | GATAGCGTTTGTTTCGAG | Variable |
| DNTR10 | GATCCATCAATCTTTCTC | CGCACTTTAGGATTATTA | Variable |
| DNTR19 | GCACTAACGTTTGCTGCC | GGTATCAAGGCAGCTACG | Variable |
Table adapted from PCR conditions for MLVA of D. nodosus
Comparative Genomics Approaches:
Analyze nqrE sequence variation across D. nodosus strains with different virulence profiles
Examine co-evolution of nqrE with other virulence factors such as fimA (fimbrial subunit gene)
By integrating these methodologies, researchers can comprehensively evaluate the role of NqrE in D. nodosus physiology and its contribution to footrot pathogenesis.
Comparative analysis of the NqrE subunit across different bacterial species reveals important structural and functional conservation patterns, as well as species-specific adaptations:
Sequence Homology Analysis:
When comparing the amino acid sequences of NqrE from D. nodosus with other bacterial species, we observe:
High conservation in transmembrane domains and Na+ binding motifs
Greater sequence divergence in loop regions connecting transmembrane segments
Conservation of key functional residues involved in electron transport
Amino Acid Sequence Comparison:
| Bacterial Species | Sequence Length (aa) | Identity with D. nodosus NqrE (%) | Notable Structural Features |
|---|---|---|---|
| D. nodosus (VCS1703A) | 203 | 100 | Benchmark sequence |
| Pseudoalteromonas atlantica | 202 | ~65 | Similar hydrophobicity profile |
| Vibrio cholerae | 198 | ~55 | Additional lipid interaction sites |
| Neisseria meningitidis | 200 | ~50 | Modified N-terminus region |
Functional Comparisons:
The NQR complex across different bacterial species shows conserved core functions but with species-specific adaptations:
Common Functions:
NADH oxidation coupled to Na+ translocation
Generation of sodium motive force (SMF)
Role in respiration and energy metabolism
Species-Specific Adaptations:
Evolutionary Implications:
Phylogenetic analysis suggests that:
The NQR complex likely evolved from ancestral redox enzyme systems
NqrE exhibits signs of purifying selection with dN/dS ratios typically <1, indicating stabilizing selective pressure
The nqr operon organization (including nqrE) is highly conserved across species, suggesting functional constraints
Understanding these structural and functional relationships can inform research into potential antibiotic targets that could selectively inhibit D. nodosus NqrE while minimizing effects on commensal bacteria.
Genomic analysis of D. nodosus provides several important insights regarding the evolution and adaptation of the NQR complex:
Genomic Context and Operon Structure:
The complete genome sequencing of D. nodosus strains has revealed that:
The nqr genes in D. nodosus are organized in an operon structure (nqrABCDEF)
Additional genes involved in NQR assembly and function (apbE and nqrM) are located downstream of the structural genes
The operon structure is conserved across different D. nodosus strains, suggesting functional constraints
Comparative Genomics Findings:
Analysis of the D. nodosus JKS-07B genome (1,311,533 bp, GC content 44.38%) and comparison with other strains reveals:
High sequence conservation of NQR complex genes (98.63% sequence homology with reference genome VCS1703A)
Specific SNPs and InDels that may influence NQR function in different strains
Evidence of lateral gene transfer in the D. nodosus genome, which may have influenced NQR evolution
Evolutionary Adaptation Signals:
Several evolutionary signatures are observed in the NQR complex:
Selective Pressure Analysis:
Evidence of purifying selection on nqr genes suggests functional importance
Conservation of key catalytic and structural residues across strains
Strain Variation and Virulence:
Host-Pathogen Co-evolution:
Adaptation of the NQR complex to the anaerobic environment of sheep hooves
Possible selection for optimal function in the unique niche of hoof infections
Metabolic Integration:
Evolution of regulatory mechanisms linking NQR function to iron acquisition systems
Development of specialized energy metabolism suited to the footrot infection environment
These genomic insights suggest that the NQR complex represents an evolutionarily conserved, yet adaptable machinery that contributes to D. nodosus survival and pathogenicity. The relatively small genome size of D. nodosus (approximately 1.3 Mb) and the retention of the complete NQR system emphasizes the essential nature of this enzyme complex for the bacterium's survival and pathogenicity.
Recombinant D. nodosus NqrE presents a novel target for vaccine development against footrot, with several strategic approaches that merit investigation:
Rationale for NqrE as a Vaccine Target:
Surface exposure of portions of the NqrE protein in the bacterial membrane
Essential role in energy metabolism making functional escape mutations less likely
Relative conservation across D. nodosus strains compared to more variable surface antigens
Connection to iron homeostasis, a pathway critical for in vivo survival
Potential Vaccine Strategies:
Subunit Vaccine Approach:
Use purified recombinant NqrE (full-length or immunogenic fragments)
Combine with appropriate adjuvants to enhance immunogenicity
Methodological considerations:
Express in E. coli using optimized protocols to ensure proper folding
Consider fusion partners (thioredoxin, MBP) to improve stability and immunogenicity
Purification under conditions that preserve immunogenic epitopes
Multi-antigen Combinatorial Approach:
Epitope-based Design:
Identify and synthesize conserved, immunogenic epitopes from NqrE
Create chimeric constructs with multiple epitopes from different virulence factors
Advantages include improved safety profile and targeted immune response
Experimental Evaluation Protocol:
Immunogenicity Assessment:
Animal immunization with various NqrE-based formulations
Measure antibody titers using ELISA and functional assays
Assess cellular immune responses via lymphocyte proliferation assays
Protection Studies:
Cross-protection Analysis:
Challenges and Considerations:
Potential toxicity of recombinant NqrE for host cells may require modification strategies
Proper folding of membrane protein antigens is critical for eliciting protective antibodies
Combination with existing vaccine approaches may be necessary for optimal protection
Field trials would need to account for environmental factors influencing footrot persistence
This approach represents a departure from traditional footrot vaccine strategies that have focused primarily on fimbrial antigens, potentially offering broader protection across D. nodosus serogroups.
The critical role of NqrE in D. nodosus energy metabolism makes it an attractive target for novel antimicrobial development with several strategic advantages:
Theoretical Basis for NqrE Inhibition:
Metabolic Vulnerability:
NQR complex is essential for respiratory energy generation
Inhibition would disrupt Na+ gradient and subsequent ATP production
Bacterial growth would be compromised even under sublethal inhibition
Linked Pathways Effect:
Structural Uniqueness:
NQR's structure differs significantly from mammalian respiratory complexes
Bacterial Na+-dependent respiration represents a specific target absent in host cells
Inhibitor Development Strategies:
Structure-Based Drug Design:
Develop atomic models of D. nodosus NqrE using homology modeling
Identify potential binding pockets through in silico analysis
Perform virtual screening of compound libraries against predicted binding sites
High-Throughput Screening:
Develop assays measuring NQR activity (NADH oxidation, Na+ transport)
Screen chemical libraries for compounds inhibiting these functions
Optimize lead compounds for improved potency and selectivity
Peptide-Based Inhibitors:
Design peptides that mimic critical interaction surfaces of NqrE
Target protein-protein interactions within the NQR complex
Conjugate with cell-penetrating peptides to improve cellular delivery
Evaluation and Validation Approaches:
In Vitro Assessment:
Measure inhibition of recombinant NqrE function
Assess impact on bacterial growth and survival
Determine minimum inhibitory concentrations (MICs)
Specificity Testing:
Evaluate effects on mammalian cell viability
Test against other bacterial species to determine spectrum of activity
Assess potential for resistance development
In Vivo Testing:
Evaluate efficacy in animal models of footrot
Determine tissue distribution and pharmacokinetics
Assess potential for topical application in hoof treatments
Challenges and Considerations:
Transmembrane nature of NqrE presents challenges for inhibitor design and delivery
Need for highly specific inhibitors to avoid disruption of host cellular processes
Potential for development of resistance through mutations in NqrE
Formulation challenges for application in the unique environment of hoof infections
This antimicrobial approach would represent a novel mechanism of action distinct from current antibiotics used in footrot treatment, potentially addressing issues of antimicrobial resistance in veterinary medicine.
Current research is employing sophisticated molecular techniques to characterize strain variations in D. nodosus NqrE and elucidate their impact on virulence:
Genomic Approaches:
Whole Genome Sequencing and Comparative Genomics:
Multilocus Sequence Typing (MLST) and MLVA:
Functional Genomics Methods:
Transcriptomics:
Proteomics:
Comparative proteome analysis between wild-type and mutant strains
Identification of protein interaction networks involving NqrE
Post-translational modifications affecting NqrE function
Structure-Function Analysis:
Site-Directed Mutagenesis:
Targeted modification of conserved residues in NqrE
Assessment of functional impact on Na+ transport and respiratory activity
Correlation of specific amino acid variations with virulence profiles
Protein Modeling and Simulation:
Computational prediction of NqrE structure based on homology modeling
Molecular dynamics simulations to understand conformational dynamics
Prediction of strain-specific structural alterations
Virulence Correlation Studies:
Recent research has established methods to differentiate virulent from benign strains:
PCR detection of specific virulence markers like aprV2/aprB2 and intA genes
These approaches are being integrated with NqrE variation data to establish potential correlations
The table below summarizes key molecular markers used for virulence assessment in D. nodosus:
These advanced molecular approaches are providing unprecedented insights into the relationship between NqrE variation and D. nodosus virulence, with important implications for diagnostic, therapeutic, and preventive strategies.
The production of functional recombinant NqrE for structural studies presents significant challenges that current research is addressing through innovative approaches:
Current Technical Challenges:
Membrane Protein Expression Barriers:
Structural Characterization Difficulties:
Inherent flexibility of membrane proteins
Challenges in obtaining diffraction-quality crystals
Limited success with traditional structural biology methods
Functional Reconstitution Issues:
Innovative Solutions and Emerging Approaches:
Alternative Expression Systems:
Cell-free protein synthesis systems optimized for membrane proteins
Specialized E. coli strains (C41/C43) engineered for toxic membrane proteins
Insect cell or mammalian expression systems for complex membrane proteins
Fusion Partners and Engineering:
Novel fusion constructs beyond traditional thioredoxin tags
Truncation strategies targeting soluble domains for initial structural studies
Chimeric constructs with well-characterized membrane proteins
Advanced Stabilization Techniques:
Systematic detergent screening using high-throughput approaches
Nanodiscs or lipid cubic phase technologies for membrane protein stabilization
Conformation-specific nanobodies to stabilize specific protein conformations
Cutting-Edge Structural Methods:
Cryo-electron microscopy (cryo-EM) for membrane protein structure determination
Solid-state NMR approaches for membrane protein analysis
Integrated structural biology combining multiple complementary techniques
Optimization Strategies for Research Applications:
Expression Protocol Refinements:
Precise control of expression rates through tunable promoter systems
Co-expression with chaperones and assembly factors
Optimal induction conditions (temperature, time, inducer concentration)
Purification Improvements:
Gentle solubilization using novel detergents or styrene maleic acid copolymer (SMA) approach
Affinity tag placement optimization to minimize interference with function
On-column refolding protocols for recovered proteins from inclusion bodies
Functional Validation Approaches:
Development of sensitive assays for Na+ transport function
Reconstitution into proteoliposomes for activity measurements
Spectroscopic methods to monitor cofactor incorporation and electron transfer
The implementation of these strategies represents the frontier of research on membrane proteins like NqrE, with each technological advance bringing structural and functional studies closer to feasibility. Success in these approaches would provide unprecedented insights into the structure-function relationship of NqrE and enable rational design of inhibitors or vaccines targeting this protein.