Recombinant Elongation factor 1-alpha

Shipped with Ice Packs
In Stock

Product Specs

Form
Lyophilized powder. We will preferentially ship the available format. If you have specific format requirements, please note them when ordering.
Lead Time
Delivery times vary by purchase method and location. Consult your local distributor for specifics. All proteins ship with blue ice packs by default. Request dry ice in advance (extra fees apply).
Notes
Avoid repeated freeze-thaw cycles. Working aliquots are stable at 4°C for up to one week.
Reconstitution
Briefly centrifuge the vial before opening. Reconstitute in sterile deionized water to 0.1-1.0 mg/mL. Add 5-50% glycerol (final concentration) and aliquot for long-term storage at -20°C/-80°C. Our default final glycerol concentration is 50%.
Shelf Life
Shelf life depends on storage conditions, buffer components, temperature, and protein stability. Liquid form is generally stable for 6 months at -20°C/-80°C. Lyophilized form is generally stable for 12 months at -20°C/-80°C.
Storage Condition
Store at -20°C/-80°C upon receipt. Aliquot for multiple uses. Avoid repeated freeze-thaw cycles.
Tag Info
Tag type is determined during manufacturing. If you require a specific tag, please inform us and we will prioritize its development.
Synonyms
Elongation factor 1-alpha; EF-1-alpha; Fragment
Buffer Before Lyophilization
Tris/PBS-based buffer, 6% Trehalose.
Datasheet
Please contact us to get it.
Expression Region
1-15
Protein Length
full length protein
Purity
>85% (SDS-PAGE)
Species
Microplitis croceipes (Braconid wasp)
Target Protein Sequence
AKEKIHINIV VIGHV
Uniprot No.

Target Background

Function
This protein facilitates GTP-dependent binding of aminoacyl-tRNA to the ribosomal A-site during protein synthesis.
Protein Families
GTP-binding elongation factor family, EF-Tu/EF-1A subfamily
Subcellular Location
Cytoplasm.

Q&A

What is Elongation Factor 1-Alpha and what is its primary function in cellular systems?

Elongation Factor 1-Alpha (EF-1α) is a ubiquitous and highly conserved cytosolic protein found across eukaryotic organisms. Its primary function involves GTP-dependent binding and delivery of aminoacyl-tRNAs to the A site of ribosomes during protein biosynthesis . This process ensures correct amino acid incorporation during translation elongation. Beyond this canonical role, EF-1α participates in numerous biological processes including cell growth and proliferation, vesicular transmission, protein formation, development of mitotic apparatus, signal transduction, DNA replication/repair, and apoptosis . This multifunctionality makes EF-1α an essential component of cellular machinery beyond its translational role.

How are EF-1α isoforms distributed across different tissues and species?

In mammals, two main paralogs exist: eEF1A1 and eEF1A2, which share approximately 90% amino acid sequence homology . These isoforms demonstrate differential tissue distribution and functional properties:

IsoformExpression PatternFunctional Characteristics
eEF1A1Brain, placenta, lung, liver, kidney, pancreas, and most cellsUbiquitously expressed, induces HSP70 during heat shock
eEF1A2Brain, heart, skeletal muscleRestricted to adult neuronal and muscle cells

The promoter regions of these isoforms show high sequence similarity, though eEF1A2 contains an additional 81 bp SV40 small antigen sequence at the 5′-end . In plants, such as tomato, EF-1α belongs to a small multigene family with 4-8 members, with higher expression in developing tissues that correlate with increased protein synthesis demands . Various parasites, including Haemonchus contortus, Trypanosoma brucei, and Giardia intestinalis, also express EF-1α variants that may play roles in host-parasite interactions .

What structural characteristics define recombinant EF-1α proteins?

Recombinant EF-1α proteins typically maintain the highly conserved structural features found in native EF-1α. These include:

  • A three-domain architecture with domain I containing a Rossmann fold for GTP/GDP binding

  • A molecular weight of approximately 50 kDa

  • High sequence conservation across species, with mammalian EF-1α showing 75-78% similarity to EF-1α from lower eukaryotes and plants

  • The presence of specific motifs for GTP binding and hydrolysis

When producing recombinant EF-1α, researchers often utilize expression systems such as pET32a vectors in E. coli BL21(DE3), which incorporate fusion tags to enhance solubility and facilitate purification . These recombinant proteins maintain functional characteristics of native EF-1α while providing experimental advantages for in vitro studies.

What are the optimal protocols for cloning and expressing recombinant EF-1α?

Successful production of recombinant EF-1α requires careful optimization at multiple experimental stages:

Gene Amplification and Cloning:

  • Extract total RNA from appropriate tissue samples

  • Synthesize cDNA using reverse transcriptase and oligo(dT) primers

  • Amplify the EF-1α coding sequence using gene-specific primers with appropriate restriction sites

  • Clone the amplified product into an expression vector (e.g., pET32a for bacterial expression)

  • Verify the sequence integrity through DNA sequencing

Protein Expression:

  • Transform the validated construct into E. coli BL21(DE3) or other suitable expression hosts

  • Grow transformed bacteria to mid-log phase (OD₆₀₀ = 0.6-0.8)

  • Induce protein expression with IPTG (typically 1mM) at 37°C for 4-6 hours

  • For improved solubility, consider lower induction temperatures (16-25°C) overnight

  • Harvest cells by centrifugation and lyse using appropriate methods (sonication or mechanical disruption)

Protein Purification:

  • Clarify the lysate by high-speed centrifugation

  • Apply the supernatant to nickel affinity chromatography for His-tagged proteins

  • Wash extensively to remove non-specifically bound proteins

  • Elute with an imidazole gradient

  • Consider additional purification steps such as ion exchange or size exclusion chromatography

  • Dialyze against an appropriate storage buffer containing glycerol to maintain stability

For parasite-derived EF-1α such as HcEF-1α, these methods have yielded functional recombinant protein suitable for immunological and biochemical studies .

How can the binding of recombinant EF-1α to cellular components be assessed?

Multiple complementary approaches can be employed to characterize recombinant EF-1α interactions with cellular components:

Immunofluorescence Assay (IFA):

  • Incubate target cells (e.g., PBMCs) with recombinant EF-1α (10 μg/mL) in appropriate conditions (37°C, 5% CO₂, 2 hours)

  • Wash cells to remove unbound protein

  • Fix cells with paraformaldehyde (4%)

  • Permeabilize if investigating intracellular binding

  • Block with bovine serum albumin (5%)

  • Probe with primary antibodies against recombinant EF-1α

  • Detect using fluorophore-conjugated secondary antibodies

  • Analyze using confocal microscopy to determine binding patterns and subcellular localization

Flow Cytometry Analysis:

  • Incubate cells with fluorescently labeled recombinant EF-1α

  • Wash to remove unbound protein

  • Analyze binding using flow cytometry to quantify:

    • Percentage of positive cells

    • Mean fluorescence intensity

    • Binding kinetics through time-course experiments

Co-immunoprecipitation:

  • Incubate cell lysates with recombinant EF-1α

  • Precipitate using antibodies against EF-1α or potential binding partners

  • Analyze precipitated complexes by Western blotting

  • Identify novel interactions through mass spectrometry analysis

These methods have successfully demonstrated that recombinant HcEF-1α binds to the surface of goat PBMCs, providing insight into host-parasite interactions .

What are the recommended approaches for evaluating recombinant EF-1α effects on immune cell functions?

A comprehensive assessment of recombinant EF-1α effects on immune cell functions requires multiple experimental approaches:

Cytokine Production Analysis:

  • Incubate immune cells (e.g., PBMCs) with varying concentrations of recombinant EF-1α (10-80 μg/mL)

  • Include appropriate controls (PBS and vector protein controls)

  • Culture for 24-72 hours under standard conditions (37°C, 5% CO₂)

  • Collect supernatants for protein detection or cell pellets for gene expression analysis

  • Quantify cytokine levels using ELISA or RT-qPCR with cytokine-specific primers

For RT-qPCR analysis, primers can be designed as follows:

CytokineForward Primer (5'-3')Reverse Primer (5'-3')Amplification Efficiency (%)
IL-4GGAGCTGCCCATGAGAATGCTGGAGGACATCAAGT97.63
IL-10TTTCCCTGACTGCCCTCTCTCTCCCCTCATCACTGT99.26
IL-17TTGTAAAGGCAGGGGTCATCGGTGGAGCGCTTGTGATAAT96.68
IFN-γGAACGGCAGCTCTGAGAAACGGTTAGATTTTGGCGACAGG98.02
TGF-β1CATGAACCGGCCCTTCCTGAAGTCAATGTAGAGCTGACGAACA98.98

Cell Proliferation Assessment:

  • Seed cells in 96-well plates (1 × 10⁶ cells/mL)

  • Activate with ConA (10 μg/mL) if appropriate

  • Add different concentrations of recombinant EF-1α and controls

  • Incubate for 72 hours at 37°C with 5% CO₂

  • Add cell counting reagent (e.g., CCK-8) 4 hours before endpoint

  • Measure absorbance at 450 nm using a microplate reader

Cell Migration Evaluation:

  • Use Transwell migration chambers

  • Place recombinant EF-1α in the lower chamber as a potential chemoattractant

  • Add cells to the upper chamber

  • Allow migration for 4-6 hours

  • Count migrated cells using microscopy or flow cytometry

  • Calculate migration index relative to control conditions

Surface Molecule Expression Analysis:

  • Incubate cells with recombinant EF-1α

  • Stain with fluorescently labeled antibodies against surface molecules (e.g., MHC-I, MHC-II)

  • Analyze using flow cytometry

  • Calculate percentage of positive cells and mean fluorescence intensity

Studies with recombinant HcEF-1α have demonstrated significant modulatory effects on goat PBMC functions, including altered cytokine production, increased cell migration and proliferation, and modulated MHC-II expression .

How can recombinant EF-1α be utilized to investigate host-parasite interactions?

Recombinant EF-1α derived from parasites serves as a valuable tool for dissecting complex host-parasite interactions:

Immune Modulation Studies:
Recombinant parasite EF-1α (e.g., HcEF-1α from Haemonchus contortus) has been shown to modulate host immune responses in several ways:

  • Altering cytokine production profiles (increasing IL-4, TGF-β1, IFN-γ, and IL-17, while decreasing IL-10)

  • Enhancing cell migration and proliferation

  • Increasing cell apoptosis

  • Decreasing nitric oxide production

  • Modulating MHC-II expression

These immunomodulatory effects provide insights into how parasites may evade host immune responses to establish successful infections.

Binding Partner Identification:

  • Use recombinant parasite EF-1α as bait in pull-down assays with host cell lysates

  • Identify binding partners through mass spectrometry

  • Validate interactions using co-immunoprecipitation and surface plasmon resonance

  • Map interaction domains through truncation mutants

Vaccine Development Evaluation:
As EF-1α is recognized by sera from infected hosts, its potential as a vaccine candidate can be assessed by:

  • Immunization trials in animal models

  • Analysis of protective antibody responses

  • Evaluation of cell-mediated immunity

  • Challenge infections to assess protective efficacy

Structural and Functional Comparison:
Compare parasite and host EF-1α to identify:

  • Unique structural features that could be targeted for therapeutic intervention

  • Differential binding properties to host molecules

  • Species-specific functional adaptations

These applications collectively enhance our understanding of host-parasite relationships and may reveal new intervention strategies for parasitic diseases.

What is the role of EF-1α in viral replication and how can recombinant EF-1α be used to study these interactions?

EF-1α plays significant roles in viral replication, particularly for HIV-1 and other retroviruses:

Interaction with Viral Proteins:
Research has demonstrated that EF-1α interacts with HIV-1 Gag polyprotein, particularly through:

  • The matrix (MA) domain of Gag

  • The nucleocapsid (NC) domain, which provides a second, independent EF-1α-binding site

These interactions can be studied using recombinant EF-1α through:

  • Pull-down assays and co-immunoprecipitation

  • Surface plasmon resonance to determine binding kinetics

  • Yeast two-hybrid screening to identify specific interaction domains

Effects on Viral Translation:
The interaction between HIV-1 MA and EF-1α impairs translation in vitro, suggesting a regulatory mechanism where:

  • Accumulated Gag proteins bind EF-1α

  • This binding inhibits normal translation functions

  • Inhibition may help release viral RNA from polysomes

  • The released RNA becomes available for packaging into virions

RNA-Mediated Interactions:
Evidence suggests that the Gag-EF-1α interaction is mediated by RNA:

  • Basic residues in MA and NC are required for binding to EF-1α

  • RNase treatment disrupts the interaction

  • Gag mutants with reduced EF-1α-binding show impaired tRNA association

Virion Incorporation:
EF-1α is specifically incorporated into HIV-1 virion membranes where it:

  • Undergoes viral protease-mediated cleavage

  • Is protected from digestion by exogenously added subtilisin

  • Shows specificity for lentiviral virions (does not associate with non-lentiviral MAs or Moloney murine leukemia virus virions)

These findings highlight the importance of EF-1α in viral replication and potential antiviral targets.

How does recombinant EF-1α expression differ between developmental stages and tissues?

Understanding differential expression patterns of EF-1α provides insights into its diverse biological roles:

Developmental Stage Variation:
In plants like tomato, EF-1α shows developmental regulation:

  • Higher EF-1α mRNA levels are found in developing tissues (young leaves and green fruit)

  • Lower expression occurs in older tissues

  • This pattern correlates with increased protein synthesis demands during development

Tissue-Specific Expression:
In mammals, the two EF-1α isoforms show distinct tissue-specific patterns:

  • eEF1A1 is ubiquitously expressed in most tissues including brain, placenta, lung, liver, kidney, and pancreas

  • eEF1A2 expression is restricted to adult neuronal and muscle cells (brain, heart, and skeletal muscle)

Methodological Approaches for Studying Expression Patterns:

  • Quantitative RT-PCR using isoform-specific primers to distinguish between EF-1α variants

  • In situ hybridization for spatial localization of mRNA in tissues

  • Western blotting with isoform-specific antibodies for protein detection

  • Immunohistochemistry for cellular and subcellular localization

  • Promoter-reporter constructs to study transcriptional regulation

Functional Implications:
The differential expression of EF-1α isoforms suggests specialized roles:

  • eEF1A1, but not eEF1A2, induces HSP70 during heat shock, indicating stress-specific functions

  • Tissue-specific expression of eEF1A2 in terminally differentiated cells suggests roles beyond protein synthesis

  • Developmental regulation in plants correlates with growth and differentiation processes

Understanding these expression patterns provides context for interpreting experimental results with recombinant EF-1α and designing targeted interventions.

What are common challenges in producing functional recombinant EF-1α and how can they be addressed?

Producing functional recombinant EF-1α presents several challenges that can be systematically addressed:

Protein Solubility Issues:

ChallengeSolution Approach
Formation of inclusion bodiesLower induction temperature (16-20°C)
Use solubility-enhancing fusion tags (e.g., pET32a with thioredoxin tag)
Optimize IPTG concentration (0.1-0.5 mM instead of 1 mM)
Aggregation during purificationInclude stabilizing agents (glycerol, low concentrations of detergents)
Optimize buffer pH and ionic strength
Consider on-column refolding techniques

Maintaining Functional Activity:

ChallengeSolution Approach
Loss of GTP-binding activityInclude GTP or non-hydrolyzable GTP analogs in purification buffers
Minimize exposure to reducing agents
Validate functionality through GTP binding assays
Compromised aminoacyl-tRNA bindingEnsure proper protein folding through gentle purification conditions
Verify activity through in vitro translation assays
Consider co-expression with molecular chaperones

Endotoxin Contamination:
For immunological studies, bacterial endotoxins can confound results:

  • Use endotoxin removal columns or polymyxin B during purification

  • Validate endotoxin levels using Limulus Amebocyte Lysate (LAL) assay

  • Consider non-bacterial expression systems for critical applications

Tag Interference:
Fusion tags may interfere with protein function:

  • Compare tagged and tag-cleaved versions of the protein

  • Use small, unobtrusive tags when possible

  • Place tags at termini least likely to affect function based on structural information

These strategies have been successfully implemented to produce functional recombinant HcEF-1α suitable for immune modulation studies .

How can researchers verify the structural and functional integrity of recombinant EF-1α?

Comprehensive validation of recombinant EF-1α requires multiple complementary approaches:

Structural Validation:

  • SDS-PAGE and Western blotting to confirm molecular weight and immunoreactivity

  • Circular dichroism (CD) spectroscopy to assess secondary structure elements

  • Size exclusion chromatography to verify monomeric state and absence of aggregation

  • Mass spectrometry for accurate mass determination and identification of post-translational modifications

Immunological Verification:

  • Confirm recognition by antibodies against native EF-1α

  • For parasite EF-1α, verify recognition by sera from infected hosts

  • Analyze cross-reactivity with related EF-1α proteins from different species

Functional Validation:

  • GTP binding assays using fluorescent GTP analogs or isothermal titration calorimetry

  • GTPase activity measurement using malachite green phosphate assay

  • Aminoacyl-tRNA binding assays using fluorescently labeled tRNAs

  • In vitro translation assays to confirm translational elongation activity

Application-Specific Validation:
For parasite EF-1α like HcEF-1α, verify:

  • Binding to host immune cells through immunofluorescence or flow cytometry

  • Immunomodulatory effects on cytokine production, cell proliferation, and other immune parameters

  • Specificity of these effects compared to control proteins

These validation approaches ensure that experimental observations truly reflect the biological properties of EF-1α rather than artifacts of recombinant production.

What strategies are effective for studying differential functions of EF-1α isoforms?

To elucidate the distinct functions of EF-1α isoforms (such as eEF1A1 vs. eEF1A2 in mammals), researchers should employ several strategic approaches:

Isoform-Specific Expression Systems:

  • Generate recombinant constructs for each isoform with identical tags

  • Ensure equivalent expression and purification methods for direct comparison

  • Validate isoform identity by mass spectrometry or isoform-specific antibodies

Domain Mapping and Mutagenesis:

  • Create chimeric constructs with domains exchanged between isoforms

  • Introduce specific mutations at divergent amino acid positions

  • Analyze which regions confer isoform-specific functions

Comparative Binding Partner Analysis:

  • Perform isoform-specific pull-downs followed by mass spectrometry

  • Use yeast two-hybrid screens with different isoforms as bait

  • Validate key differential interactions by co-immunoprecipitation

Differential Expression Analysis:

  • Compare expression patterns across tissues and developmental stages

  • Correlate expression with specific cellular functions

  • Analyze promoter activities to understand transcriptional regulation

Functional Complementation Studies:

  • Express individual isoforms in cells where endogenous EF-1α has been depleted

  • Assess rescue of various cellular functions

  • Compare responses to different cellular stresses (e.g., heat shock, oxidative stress)

These approaches enable systematic characterization of isoform-specific roles, providing insights into the evolutionary and physiological significance of EF-1α diversity.

What statistical approaches are recommended for analyzing recombinant EF-1α experimental data?

Experimental Design Considerations:

  • Include at least three independent biological replicates

  • Use appropriate positive controls (e.g., ConA for lymphocyte stimulation) and negative controls (PBS, vector protein)

  • Test multiple concentration points (e.g., 10, 20, 40, and 80 μg/mL) for dose-response relationships

Statistical Tests for Common Experimental Scenarios:

Experimental ScenarioRecommended Statistical Approach
Comparison of two experimental groupsStudent's t-test (parametric) or Mann-Whitney U test (non-parametric)
Multiple group comparisonsOne-way ANOVA with post-hoc tests (Tukey's HSD for all pairwise comparisons, Dunnett's for comparisons to control)
Dose-response experimentsLinear or non-linear regression analysis with EC50 determination
Time-course experimentsRepeated measures ANOVA or mixed-effects models

Power Analysis and Sample Size:

  • Determine minimum sample size needed for desired statistical power

  • Consider effect size in power calculations

  • Report confidence intervals alongside p-values

  • Apply appropriate corrections for multiple comparisons

Data Visualization Strategies:

These statistical approaches have been successfully applied in studies of recombinant HcEF-1α effects on immune cells, revealing significant modulatory effects on cytokine production, cell proliferation, and other immune parameters .

How should researchers interpret contradictory findings regarding recombinant EF-1α functions?

When faced with contradictory findings regarding recombinant EF-1α functions, researchers should adopt a systematic interpretative framework:

Source and Preparation Differences:

  • Compare the origin of EF-1α (species, isoform, tissue source)

  • Evaluate expression systems used (bacterial, yeast, mammalian cells)

  • Assess purification methods and potential effects on protein conformation

  • Consider the presence/absence of fusion tags and their potential interference

Experimental Context Variations:

  • Compare cell types or model organisms used

  • Evaluate buffer compositions and reaction conditions

  • Consider physiological relevance of protein concentrations

  • Assess the presence of cofactors or binding partners

Methodological Considerations:

  • Compare sensitivity and specificity of detection methods

  • Evaluate the validity of readout systems

  • Consider potential artifacts from experimental manipulations

  • Assess the statistical robustness of contradictory findings

Resolution Approaches:

  • Design experiments that directly address contradictions

  • Perform side-by-side comparisons under identical conditions

  • Use multiple, complementary techniques to validate findings

  • Consider collaborative studies between laboratories reporting contradictory results

This systematic approach helps distinguish genuine biological complexity from technical artifacts and leads to a more nuanced understanding of EF-1α's multifunctional nature across different biological contexts.

What bioinformatic resources are most valuable for analyzing EF-1α sequence, structure, and function relationships?

Comprehensive analysis of EF-1α requires integration of multiple bioinformatic tools and databases:

Sequence Analysis Tools:

  • BLAST and PSI-BLAST for sequence similarity searches

  • Clustal Omega or MUSCLE for multiple sequence alignments

  • MEGA or PHYLIP for phylogenetic analysis

  • SMART, Pfam, and InterPro for domain identification

  • ConSurf for evolutionary conservation mapping

Structural Analysis Resources:

  • Protein Data Bank (PDB) for experimental structures

  • SWISS-MODEL or I-TASSER for homology modeling

  • PyMOL or UCSF Chimera for structure visualization and analysis

  • FTMap for binding site prediction

  • PROCHECK or MolProbity for structure validation

Functional Prediction Tools:

  • STRING for protein-protein interaction networks

  • NetPhos or GPS for phosphorylation site prediction

  • ProtParam for physicochemical property prediction

  • PredictProtein for functional site prediction

Specialized Databases:

  • UniProt for curated protein information

  • Ensembl or NCBI Gene for genomic context

  • KEGG or Reactome for pathway information

By integrating these resources, researchers can gain comprehensive insights into EF-1α's evolutionary history, structural features, and functional mechanisms, facilitating hypothesis generation and experimental design.

Quick Inquiry

Personal Email Detected
Please use an institutional or corporate email address for inquiries. Personal email accounts ( such as Gmail, Yahoo, and Outlook) are not accepted. *
© Copyright 2025 TheBiotek. All Rights Reserved.